Please wait a minute...
Frontiers of Agriculture in China

ISSN 1673-7334

ISSN 1673-744X(Online)

CN 11-5729/S

Front Agric Chin    2009, Vol. 3 Issue (1) : 43-46     DOI: 10.1007/s11703-009-0010-5
RESEARCH ARTICLE |
Improvement of megaprimer method for site-directed mutagenesis and its application to phytase
Haiqiang LU1, Hongwei YU1, Runfang GUO1, Yingmin JIA1,2()
1. Food Science and Technology College Agricultural University of Hebei, Baoding 071000, China; 2. Hebei University of Science and Technology, Shijiazhuang 05000,China
Download: PDF(116 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

Site-directed mutagenesis is used extensively for probing gene function. In this paper we describe an improved megaprimer method to the site-directed mutagenesis of phytase from Aspergillus niger, which allowed the mutations to be performed more efficiently in less time than other traditional methods. Three rounds of PCR and two pairs of primers were required in this method, and additionally, the restriction enzyme Dpn I was used for the elimination of template instead of the gel purification in this process. The entire procedure was performed in one tube. Moreover, this method was easier for obtaining large mutant genes than other methods. We successfully carried out the site-directed mutagenesis of phytase by adopting this method.

Keywords site-directed mutagenesis      phytase      the single-stranded product      PCR     
Corresponding Authors: JIA Yingmin,Email:ymjia0312@163.com   
Issue Date: 05 March 2009
URL:  
http://academic.hep.com.cn/fag/EN/10.1007/s11703-009-0010-5     OR     http://academic.hep.com.cn/fag/EN/Y2009/V3/I1/43
Fig.1  Schematic diagram of the improved site-directed mutagenesis method
name of primersequence of primers (5'-3')
Primer UGTGAATTCCTGGCAGTCCCCGCTTC
Primer DTCGCGGCCTAAGCAAAACACTCCG
Primer U’TGCCTGCAGGTCGACGATTGTGAATTCC
Primer MCATGACCGTAGTACTTCTCCAGGGACTGGAGGTA
Tab.1  Primers used in the experiments
Fig.2  Optimization of key parameters and conditions for maximum efficiency of mutagenesis
Note: (a) represents the products generated from the different circulation numbers of the first PCR with 0.05 pmol?L of Primer U’. M represents DNA Marker-D (100-2000 bp). From Lane 1 to Lane 9, the number of cycles is 5, 10, 15, 20, 25, 30, 35, 40 and 45 respectively. (b) represents the effects of different circulation numbers in the first PCR with 0.05pmol?L of Primer U’. M is DNA Marker-D (100-2000 bp). From Lane 1 to Lane 8, the number of cycles is 5, 10, 15, 20, 25, 30, 35 and 40. (c) represents the products generated from the different circulation numbers of the first PCR with 0.025 pmol?L of Primer U’. M is DNA Marker-D (100-2000 bp). From Lane 1 to lane 9, the number of cycles is 5, 10, 15, 20, 25, 30, 35, 40 and 45. (d) represents the effects of the different circulation numbers of the first PCR with 0.025pmol?LPrimer U’. M is DNA Marker-D (100–2000 bp). From Lane 1 to Lane 8, the number of cycles is 5, 10, 15, 20, 25, 30, 35 and 40, respectively.
Fig.3  Comparison of the two methods
Note: Lane a shows the results of the stranded method; Lane b shows the results of the improved method; Lane M shows marker DL2000
gene namemutation sequencemutation frequency
K300EACCTCCAGTCCCTGGAGAAGTACTACGG100%(5/5)
Q297LK300EACCTCTTGTCCCTGGAGAAGTACTACGG100%(5/5)
KKACCTCCAGTCCCTGAAAAAGTACTACGG
Tab.2  Frequency of the improved megaprimer method mutation
1 Barettino D, Feigenbutz M, Valcárcel R, Stunnenberg H G (1994). Improved method for PCR-mediated site-directed mutagenesis. Nucleic Acids Research , 22(3): 541-542
doi: 10.1093/nar/22.3.541
2 Gyllensten U B, Erlich H A (1988). Generation of single-stranded DNA by the Polymerase Chain Reaction and its application to direct sequencing of the HLA-DQA. Proc Natl Acad Sci , U S A, 85(20): 7652-7656
doi: 10.1073/pnas.85.20.7652
3 Kuipers O P, Boot H J, de Vos W M (1991). Improved site-directed mutagenesis method using PCR Nucleic Acids Research , 19(16): 4558
doi: 10.1093/nar/19.16.4558
4 Ling M M, Robinson B H (1997). Approaches to DNA mutagenesis: An Overview. Analytical Biochemistry , 254(2): 157-178
doi: 10.1006/abio.1997.2428
5 Nabavi S, Nazar R N (2005). Simplified one-tube “megaprimer” polymerase chain reaction mutagenesis. Analytical Biochemistry , 345: 346-348
doi: 10.1016/j.ab.2005.06.033
6 Shenoy A R, Visweswariah S S (2003). Site-directed mutagenesis using a single mutagenic oligonucleotide and DpnI digestion of template DNA. Analytical Biochemistry , 319(2): 335-336
doi: 10.1016/S0003-2697(03)00286-0
7 Tomschy A, Tessier M, Wyss M, Brugger R, Broger C, Schnoebelen L, van Loon A P, Pasamontes L (2000). Optimization of the catalytic properties of Aspergillus fumigatus phytase based on the three-dimensional structure. Protein Science , 9(7): 1304-1311
8 Zhao X, Huo K K, Li Y Y (2000). Synonymous codon usage in Pichia pastoris. Chinese Journal of Biotechnology 16(3): 308-311
[1] Daling FENG, Shuxin XUAN, Aixia GU, Airu MA, Jiuhuan LI, Shuxing SHEN. PCR-based screening of BAC clones of different chromosomes in Chinese cabbage[J]. Front Agric Chin, 2011, 5(4): 524-528.
[2] Zhongbo XIA, Jihong XING, Xuan WANG, Bin ZHAO, Jianmin HAN, Jingao DONG. Screening of conidium development mutant of Botrytis cinerea and functional analysis of the related gene[J]. Front Agric Chin, 2011, 5(4): 479-485.
[3] Qian WANG, Wei ZHAO, Zhimin HAO, Jingao DONG. mRNA level of PKA-c gene in Setosphaeria turcica with different nutrition sources under metal ion or osmotic stress[J]. Front Agric Chin, 2011, 5(3): 361-365.
[4] John Yew Huat TANG, Farinazleen Mohamad GHAZALI, Abdul Aziz SALEHA,, Yoshitsugu NAKAGUCHI, Mitsuaki NISHIBUCHI, Son RADU. MPN-PCR enumeration of Campylobacter spp. in raw chicken meats and by-products[J]. Front Agric Chin, 2010, 4(4): 501-506.
[5] Ruijuan LI, Wenjing LU, Jinfeng ZHAO, Chengjin GUO, Kai XIAO, Chuanfan SUN, . Biochemical properties, molecular characterizations, functions, and application perspectives of phytases[J]. Front. Agric. China, 2010, 4(2): 195-209.
[6] Hongmiao SHEN, Dangyue HAN, Fenghuan YANG, Qiuxian HUANG, Longxian RAN, Zhengnan LI, . Detection of indigenous endophytic bacteria in Eucalyptus urophylla in vitro conditions[J]. Front. Agric. China, 2010, 4(1): 37-41.
[7] Qiaoyun WENG, Jihong XING, Jingao DONG, Zhiyong LI, Zhiping DONG, . Expression analysis of RUS1 and construction of RUS1 plant expressing vector[J]. Front. Agric. China, 2010, 4(1): 31-36.
[8] Tinghui LIU, Wei GUO, Weiming SUN, Yongxiang SUN. Biological characteristics of Bacillus thuringiensis strain Bt11 and identification of its cry-type genes[J]. Front Agric Chin, 2009, 3(2): 159-163.
[9] Yan ZHANG, Wenxiang YANG, Yaning LI, Daqun LIU, Ting ZHANG. A multiplex PCR method for detection of Clavibacter michiganensis subsp. michiganensis with co-amplification of its host DNA[J]. Front Agric Chin, 2009, 3(2): 140-145.
[10] Jian WANG, Yutao ZHU, Jianhua QIN, Jian WANG, Fumei ZHANG, Yuelan ZHAO. Detection of Eperythrozoon wenyoni by PCR assay[J]. Front Agric Chin, 2009, 3(1): 100-103.
[11] ZHANG Xiaohui, XU Shangzhong, GAO Xue, REN Hongyan, CHEN Jinbao. Cloning and bioinformatics analysis of cDNA encoding cattle 4 gene[J]. Front. Agric. China, 2008, 2(4): 493-497.
[12] YE Manhong, CAO Honghe, LI Hongbin, CHEN Jilan, ZHAO Guiping, ZHENG Maiqing. Association of polymorphisms in adipocyte fatty acid binding protein gene with fat-related traits in chicken[J]. Front. Agric. China, 2008, 2(4): 474-479.
[13] WANG Qiong, YANG Chaowu, LIU Yiping, QIU Mohan, ZHU Qing, JIANG Xiaosong, DU Huarui. Correlation analysis of relationships between polymorphisms of high quality chicken gene and slaughter and meat quality traits[J]. Front. Agric. China, 2008, 2(4): 512-518.
[14] ZHANG Xiaohui, XU Shangzhong, GAO Xue, ZHANG Lupei, REN Hongyan, CHEN Jinbao. The application of asymmetric PCR-SSCP in gene mutation detecting[J]. Front. Agric. China, 2008, 2(3): 361-364.
[15] GUO Li, WANG Jiaojiao, XIAO Kai. Isolation and characterization of a novel phytase gene () from soybean ( (L.) Merr.)[J]. Front. Agric. China, 2008, 2(1): 30-36.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed