Please wait a minute...
Frontiers of Agriculture in China

ISSN 1673-7334

ISSN 1673-744X(Online)

CN 11-5729/S

Front Agric Chin    2009, Vol. 3 Issue (1) : 1-6     DOI: 10.1007/s11703-009-0019-9
RESEARCH ARTICLE |
Inheritance and molecular markers for the seed coat color in Brassica juncea
Mingli YAN1, Zhongsong LIU2(), Chunyun GUAN2, Sheyuan CHEN2, Mouzhi YUAN2, Xianjun LIU2
1. Life School, Hunan University of Science and Technology, Xiangtan 410201, China; 2. Oilseed Crop Research Institute, Hunan Agricultural University, Changsha 410128, China
Download: PDF(175 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

To elucidate the inheritance of seed coat color in Brassica juncea, Sichuan Yellow inbred (PY) was crossed with the Ziyejie inbred, and their F1, F2 and BC1 and BC2 progenies, derived from backcrossing to PY, were phenotyped for seed coat color. Results showed that the yellow seed coat was controlled by two independent recessive loci. Seven brown-seeded near-isogenic lines were developed by successive backcrosses to PY and by selfing. One of the BC6F2 populations segregated for a single locus controlling seed coat color was used for mapping. Using the 88 primer pairs from sequence-related amplified polymorphism and the 500 random primers, two markers were found to be linked to the gene for brown seed coat, which were designated as SCM57 and SCM1078. The crossover between these markers and the brown seed coat loci was 2.35% and 7.06%, respectively. A sequence characterized amplified region (SCAR) marker according to Negi et al. (2000), designated as SZ1-331, was found to be linked to the gene for brown seed coat, with a cross-over estimate of 2.35%. The markers were located on the same side of the brown seed coat loci and 2.41, 7.51 and 2.41 cM away from the brown seed coat locus. The seven brown-seeded near-isogenic lines were classified into two groups by three DNA markers. They were located at the same linkage group of the marker RA2-A11 previously published by Padmaja et al. (2005).

Keywords inheritance      molecular markers      seed coat color      Brassica juncea     
Corresponding Authors: LIU Zhongsong,Email:ymljack@126.com   
Issue Date: 05 March 2009
URL:  
http://academic.hep.com.cn/fag/EN/10.1007/s11703-009-0019-9     OR     http://academic.hep.com.cn/fag/EN/Y2009/V3/I1/1
Fig.1  Pedigree of the genetic stocks used for mapping of the seed coat color in
materials and their generationseed coat color (brown∶yellow)expected ratioχ2P
Ziyejie×Sichuan Yellow F170∶01∶00.0001.000
Sichuan Yellow×Ziyejie F162∶01∶00.0001.000
(Sichuan Yellow×Ziyejie) F2122∶615∶10.267>0.50
(Ziyejie×Sichuan Yellow) F2130∶815∶10.024>0.80
Sichuan Yellow×(Ziyejie×Sichuan Yellow) BC1 F1102∶363∶10.043>0.80
Sichuan Yellow×(Sichuan Yellow×Ziyejie) BC1 F144∶123∶10.191>0.70
(BC1×Sichuan Yellow) BC2 F10∶500∶10.0001.00
(BC1×Sichuan Yellow) BC2 F128∶301∶10.035>0.80
(BC1×Sichuan Yellow) BC2 F144∶461∶10.022>0.75
(BC1×Sichuan Yellow) BC2 F146∶461∶10.0001.00
(BC1×Sichuan Yellow) BC2 F142∶381∶10.100>0.70
(BC1×Sichuan Yellow) BC2 F120∶261∶10.763>0.30
(BC1×Sichuan Yellow) BC2 F116∶181∶10.118>0.75
(BC1×Sichuan Yellow) BC2 F112∶151∶10.346>0.5
(BC1×Sichuan Yellow) BC2 F170∶263∶10.111>0.75
(BC1×Sichuan Yellow) BC2 F148∶143∶10.097>0.80
(BC1×Sichuan Yellow) BC2 F164∶263∶10.363>0.50
(BC1×Sichuan Yellow) BC2 F152∶143∶10.253>0.55
(BC1×Sichuan Yellow) BC2 F148∶203∶10.353>0.50
(BC1×Sichuan Yellow) BC2 F170∶223∶10.028>0.80
(6-BC6F3×3-BC6F3) F2162∶1115∶10.004>0.95
(6-BC6F3×3-BC6F3) F285∶515∶10.009>0.95
(6-BC6F3×3-BC6F3) F2114∶915∶10.028>0.80
Tab.1  Segregation of the seed coat color of Brassica juncea
markersprimer nameprimer sequence (5′→3′)recombination fraction/%genetic distance/cM
SCM57SCAR57F: AACCGGAAGAAAACGTCCCCR: GGCGACAAAGTTCGAGATGA2.352.41
SCM1078SCAR1078F: AAACCCAACAGATCCACAR: AGCCCAATAACCAACTCA7.067.51
SZ1-331SZ1F:ACGATCCATTCCTCGACCACR:CGTGAAACCTAATCAGCTGGC2.352.41
Tab.2  Names and primers of the SCAR markers, recombination fraction and map distances between the markers and the gene for seed coat color
Fig.2  Nucleotide sequence of the band amplified from Ziyejie using the primer pair me5+em7
Note: The primer combination me5+em7 is in bold and the primers used for SCAR are underlined.
Fig.3  Electrophoretogram of amplified products using the primer SCAR57
Note: Lanes M, H and Z represent the 100-bp ladder, Sichuan yellow and Ziyejie,respectively. Lanes 1—8 and 16—22 are the brown-seeded plants of 6–BCF and Lanes 9–15 are the yellow-seeded plants of 6–BCF.
Fig.4  Nucleotide sequence of the band from Ziyejie using the random primer S1078
Note: The random primer S1078 is in bold and the primers used for SCAR are underlined.
Fig.5  Electrophoretogram of amplified products using the primer S1078
Note: Lanes M, H and Z represent the 100-bp ladder, Sichuan yellow and Ziyejie, respectively. Lanes 1–8 and 16–22 are the brown-seeded plants of 6–BCF and Lanes 9–15 are the yellow-seeded plants of 6–BCF.
Fig.6  Electrophoretogram of amplified products using the primer SZ1
Note: Lanes M, H and Z represent the 100-bp ladder, Sichuan yellow and Ziyejie, respectively. Lanes 1–8 and 6–22 are the brown-seeded plants of 6–BCF and Lanes 9–15 are the yellow-seeded plants of 6–BCF.
1 Liu H L (2000). Oilseed Genetics and Breeding. Beijing: China Agricultural University Press, 139-149 (in Chinese)
2 Liu L W, Gong Y Q, Huang H, Zhu X W (2004). Novel molecular marker systems-SRAP and TRAP and their application. Hereditas , 26: 777-781 (in Chinese)
3 Mahmood T, Rahman M H, Stringam G R, Raney J P, Good A G (2005). Molecular markers for seed color in Brassica juncea. Genome , 48: 755-760
doi: 10.1139/g04-122
4 Michelmore R, Paran W I, Kesseli RV (1991). Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA , 88(21): 9828-9832
doi: 10.1073/pnas.88.21.9828
5 Negi M S, Devic M, Delseny M, Lakshmikumaran M (2000). Identification of AFLP fragments linked to seed coat colour in Brassica junceaand conversion to a SCAR marker for rapid selection. Theor Appl Genet , 101: 146-152
doi: 10.1007/s001220051463
6 Padmaja K L, Arumugam N, Gupta V, Mukhopadhyay A, Sodhi Y S, Pental D, Pradhan A K (2005). Mapping and tagging of seed coat colour and the identification of microsatellite markers for marker-assisted manipulation of the trait in Brassica juncea. Theor App1 Genet , 111: 8-14
7 Pradhan A K, Gupta V, Mukhopadhyay A, Arumugam N, Sodhi Y S, Pental D (2003). A high-density linkage map in Brassica juncea(Indian mustard) using AFLP and RFLP markers. Theor Appl Genet , 106: 607-614
8 Sabharwal V, Negi M S, Banga S S, Lakshmikumaran M (2004). Mapping of AFLP markers linked to seed coat colour loci in Brassica juncea(L.) Czern. Theor App1 Genet , 109: 160-166 .
9 Vera C L, Woods D L (1982). Isolation of independent gene pairs at two loci for seed coat colour in Brassica juncea. Can J Plant Sci , 62: 47-50
10 Vera C L, Woods D L, Downey R K (1979). Inheritance of seed coat colour in Brassica juncea. Can J Plant Sci , 59: 635-637
11 Yan M L (2004). Molecular biological studies of seed coat color in mustard (Brassica juncea). Dissertation for the Master’s Degree , Changsha: Hunan Agricultural University, 9-11 (in Chinese)
[1] Paul C. KORIR, Jinshe WANG, Tuanjie ZHAO, Junyi GAI, . Genetic analysis of tolerance to aluminum toxin at seedling stage in soybean based on major gene plus polygene mixed inheritance model[J]. Front. Agric. China, 2010, 4(3): 265-271.
[2] NI Sui, YAO Mingzhe, CHEN Liang, ZHAO Liping, WANG Xinchao. Germplasm and breeding research of tea plant based on DNA marker approaches[J]. Front. Agric. China, 2008, 2(2): 200-207.
[3] Junyi GAI,Yongjun WANG,Xiaolei WU,Shouyi CHEN. A comparative study on segregation analysis and QTL mapping of quantitative traits in plants—with a case in soybean[J]. Front. Agric. China, 2007, 1(1): 1-7.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed