Please wait a minute...
Frontiers of Agriculture in China

ISSN 1673-7334

ISSN 1673-744X(Online)

CN 11-5729/S

Front Agric Chin    2010, Vol. 4 Issue (4) : 394-405     DOI: 10.1007/s11703-010-1029-3
RESEARCH ARTICLE |
Identification of disease resistances in wheat-Leymus multicaulis derivatives and characterization of L. multicaulis chromatin using microsatellite DNA markers
Xiuli ZHANG1, Jinjin CAI1, Joseph M. ANDERSON2, Maolin ZHAO3, Herbert W. OHM2, Lingrang KONG1()
1. State Key Laboratory of Crop Biology, Shandong Agricultural University, Taian 271018, China; 2. Department of Agronomy, Purdue University, 915 W. State St. West Lafayette IN 47907, USA; 3. Beijing Agro-Biotechnology Research Center, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100089, China
Download: PDF(252 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

To identify resistance to Fusarium head blight (FHB), cereal yellow dwarf virus (CYDV), stem rust (Sr), and powdery mildew (Pm) in 24 common wheat (Triticum aestivum)-Leymus multicaulis addition/translocation lines that were developed cytogenetically and to verify the authenticity of these lines using microsatellite (SSR) DNA markers. Resistance to FHB was identified in the wheat-L. multicaulis addition lines, Line 9 and Line 26, which both contained L. multicaulis-specific fragments as shown by SSR markers. The translocation line, Trans 1, and the addition lines, Line 5 and Line 29, have resistance to stem rust (IT 0). Resistance to CYDV was evaluated based on virus titers measured by enzyme linked immunosorbent assay (ELISA). The addition line, Line 23, showed low virus titer (0.15), indicating resistance to CYDV. The segregation distribution of CYDV resistance in 98 F2 plants of Line 23/CS showed a significant deviation from 3∶1. Inoculation with a set of 14 differential Blumeria graminis f. sp. tritici (Bgt) isolates did not detect powdery mildew resistance in translocation line Trans 1, addition line Line 9 and the amphiploid of wheat-L. multicaulis. However, Line 26 exhibited the resistance response pattern of Kavkaz, which carries Pm8, indicating that Line 26 most likely has the powdery mildew resistance gene Pm8 inherited from its parent lines Feng Kang 7 or Feng Kang 10. Twelve SSR markers, distributed on different homeologous chromosome groups of wheat, which distinguished L. multicaulis addition/translocation chromosomes, were used to verify the presence of L. multicaulis chromatin in the putative wheat-L. multicaulis addition/translocation lines. Of the 24 addition/translocation lines investigated using the 12 polymorphic SSR markers, 18 wheat-L. multicaulis derivatives showed the expected L. multicaulis-specific fragments, indicating that all of these 18 addition/translocation lines would most likely have the introgressed L. multicaulis chromosome(s). Chromosomal rearrangements also were detected in some of the wheat-L. multicaulis introgression lines.

Keywords Triticum aestivum      Leymus multicaulis      ELISA      SSR      disease resistance     
Corresponding Authors: KONG Lingrang,Email:lkong@sdau.edu.cn   
Issue Date: 05 December 2010
URL:  
http://academic.hep.com.cn/fag/EN/10.1007/s11703-010-1029-3     OR     http://academic.hep.com.cn/fag/EN/Y2010/V4/I4/394
codeagroupleft primer (5′ to 3′)right primer (5′ to 3′)PCR product size/bpb
Wem0011cLdCCGTCGTCAGTTCAAATGGTCCAGGAATGGGTTTACTGC137
Wem0021SeGGAAGAACAAGGGCAATGGCGGCACCCTGATGTCCTC249
Wem0031SGATCTGTGACCGAGGCAGAGCTGTGGAGGTCCAAAATGT77
Wem0041LCTACCCGCCGCAGCTCTACGGTTCTTGAAGTCGGTGGTG134
Wem0051LCTCCCTCTGCCCCTCTTGCAGCTCGCCTGTATCCATCT126
Wem0061SCCTGCTCTGCCATTACTTGGTGCACCTCCATCTCCTTCTT141
Wem0132LGGTGCAGAACTCATGTGGAAGTTCGGAGAACCGACTGAAG102
Wem0142SGGCGTTCGGACGTTATATGTGACATCCGAGCAGCTAAACC122
Wem0152LAGAGGAAGCCATCCAATCTGTCTTACCCTCCCTCGAGTCC118
Wem0162SCCGCCGCCTCCTCTACTCGACGTTTCGGCGCATAGA113
Wem0172LGCGATGACTTCGGACAGGAAGAGCACCGTCTTGGTCTG110
Wem0182STTCGCGAAGCGACTACCGGCATCCTTCGTCTCGCTAAC125
Wem0193LACAAATACAAGCCCCCAAAGGCGGTGGGAAGGTTTCTTAT128
Wem0203SGACACCTTCTCTTGCTCCAAAGAAGACGTGATCAGCATGGA123
Wem0223LTCTGGATCCCTTGTCGAATCGAGGCGAGGATCTCATGGTA134
Wem0253LCGCCTCAGAGCTCTTCACCAAGATACGGTCCGTGTAGGAG237
Wem0263SCCAGCTGACCGTTATGACAAACCAATATCTGCACGTGGTC150
Wem0293STTGCCCAGGGAATGAAGTAGTCGTAAACGACTTGAACATTGC84
Wem0323SATGCTCAAGCCGAGGAAGTATAGACGCCAACAAAGCCACT148
Wem0344LTTGCACCTTTTGATCCAACCTTGCCTCACCAGACTCAGTG126
Wem0354SCAACATACAGCACCGAGAAAGCAGCTGGAACTCGCTGAAGT140
Wem0364STCACCGGAATAGGAATAGGGGGTATGGGGATAAAGCAGCA112
Wem0374LGGCAGAAGAGTTGTGGTTGAGTCCTGCTTTGCTTTGATGTG121
Wem0384LAAGCCAAGCGTTAGCTGTCTAGCTCGTTGATCTCCTCGTC109
Wem0394STATTCTTGCGCACCGAGACAGAAGACGAACCGGACCTG146
Wem0344LTTGCACCTTTTGATCCAACCTTGCCTCACCAGACTCAGTG126
Wem0405STAGCACCAGGCTTGACCAGTGGACCAAAGCCAAAAACAAA111
Wem0415LGGATGGAGAGGGACTTCCTGACTCCTCCTCCCCCAAAGTA136
Wem0425SACATCCTGGCGGAGAAGTCTGGAGAGGTCCTGGTAGGTC123
Wem0435LCGTGAAGGGGGACTGTATTTAGCAAGCGGTTGAATATTGG121
Wem0445SAGTGCACTGCAAACACAGAGAGCCGTACACCTTCATAGGC75
Wem0455LTGCAAGACATGCACACTGAAATTCCCAACAGTGCTGATCC107
Wem0405STAGCACCAGGCTTGACCAGTGGACCAAAGCCAAAAACAAA111
Wem0466LACGTTGTCTCCGTGTCATTGGGTCATGGCCTCAGTCTCA150
Wem0476SCCTTCTCGACTCCCTCTTCGCCATTGCTCGTGGACCTGT146
Wem0486LTCTGTTGTCGGCATTTCAGTTGGCGTTACATTCATTTGGA128
Wem0496SGAGGAGGACTCCATCGTCTTGCTTCCCGAACGAAGAACT119
Wem0506SAGTACTACGGAGCCGAGCAAATCGAATCGCCGAACATAAA135
Wem0516LCGACAAGAACAAAGCCTGAGCCTCTATCGCGCTGTTGATT89
Wem0527LCCTACCTACGACGCAAGTCCAGCGAGCAGAAAGCATCAAG136
Wem0537SACGCACGCTCGCTTCAATGCAGTATCGTCTCCCTCTGC130
Wem0547SAGCCAAAGGAGCTGGAGGACGGCTCCGTGCTCCTCGAC112
Wem0557LCCAAAACCCTGACCTGACCGGAACGTCCTTGAAGACGAG137
Wem0567LCCAAGTGTCAGCAACAAGCATAGACGAACACGCTGTGGTG115
Wem0577SCCGTACGCCACCAATTTTACCTGATCCAGAACTCCATCTGC128
Tab.1  Description of eSSR (Wem) primer sets and loci applied to cv. Chinese Spring, accession ‘R79’, Feng Kang 7, 10, and 13, the amphiploid, and the putative - addition/translocation lines
linesfusarium head blight (FHB)ELISAdstem rust
experiment 1a (2003)experiment 2 (2004)mean
NbFHBIcNFHBINFHBI
CS80.37±0.28250.43±0.35330.42±0.33S(0.88e±0.12)3+
FK 7f80.29±0.14190.22±0.22270.24±0.20*S(1.03±0.22)0
FK 1080.26±0.15240.29±0.28320.28±0.25S(0.96±0.20)0
FK 1350.74±0.25210.77±0.29260.77±0.28*S(0.73±0.31)3+
Amphiploid60.46±0.31160.45±0.31220.45±0.31S(0.46±0.06)2
Trans 180.46±0.30220.37±0.24300.39±0.25S(0.92±0.32)0
Trans 250.27±0.13240.48±0.25290.45±0.25S(0.91±0.21)1
Trans 330.26±0.26260.45±0.28290.43±0.28S(0.88±0.14)1
Line 490.50±0.33200.26±0.27290.34±0.31S(0.84±0.20)3+
Line 540.88±0.25220.86±0.30260.86±0.29*S(0.84±0.17)0
Line 670.48±0.31220.62±0.37290.59±0.36*S(0.81±0.57)3+
Line 770.34±0.18210.60±0.38280.52±0.36S(0.73±0.27)2
Line 970.09±0.08240.19±0.12310.17±0.12*S(0.43±0.36)0
Line 1080.64±0.24230.71±0.33310.69±0.31*S(0.77±0.14)1
Line 11110.30±0.14250.34±0.27360.33±0.24S(0.71±0.13)4
Line 1280.56±0.22250.65±0.27330.63±0.26*S(0.77±0.13)4
Line 1470.62±0.42240.78±0.32310.74±0.35*S(0.59±0.27)3+
Line 1590.40±0.37250.50±0.38340.47±0.37S(0.88±0.27)4
Line 16100.19±0.15240.29±0.23340.26±0.21*S(0.97±0.23)4
Line 1840.64±0.10270.79±0.30310.77±0.28*S(0.65±0.08)2
Line 2080.57±0.14240.65±0.29320.63±0.27*S(0.49±0.16)2
Line 2230.52±0.08220.50±0.35250.50±0.33S(0.54±0.32)4
Line 2370.79±0.29240.83±0.31310.82±0.30*R(0.15±0.21)3-
Line 2490.31±0.26230.52±0.39320.46±0.37S(0.45±0.17)2+
Line 2560.57±0.23180.31±0.32240.37±0.32S(0.65±0.24)2+
Line 2650.12±0.07230.18±0.14280.17±0.13*S(0.38±0.15)1
Line 2750.22±0.17260.37±0.29310.35±0.28S(0.52±0.21)1
Line 2840.76±0.31240.42±0.34280.47±0.35S(0.76±0.07)3+
Line 2960.36±0.15250.34±0.20310.35±0.19S(0.39±0.15)4
Ning 784050.17±0.10100.19±0.12150.18±0.12*
Len50.89±0.20100.92±0.25150.91±0.25*
P961341R(0.02±0.00)0
Tab.2  Reaction to , CYDV, and f. sp. in Chinese Spring, Feng Kang 7, 10, and 13, the amphiploid, and the 24 addition/translocation lines
Fig.1  Virus titer distribution in 98 F individuals of wheat- addition line, Line 23/CS
Pm genescultivar/lineB. graminis f. sp. tritici isolates
1234567891011121314
noneChancellorSaSSSSSSSI(S)SSSSS
1aCI14114RRSRRRRSRRVRRS
2CI14118RRSSRRRSSRRSRR
3aCI14120SSSSSSSRSRRRSR
3bCI14121RI(S)RSSSRRRI(R)SRI(S)R
3cCI14122SSSSSSSRI(S)SSSSR
3fCI15888SSSSSSSSSRSI(R)SR
4aCC/KLI(S)SRSRSSRRSSVSR
4bRonosRRRRRRRRRSSRRR
5aCC/HopeVSSSSSSSVSSRSR
6CC/12632RRSSRRRSSRRSRR
8KavkazRRRRRRRRRSSSVS
9MNRRSRRRRRRRRRRR
17AmigoRRRRRRRI(R)RI(S)I(S)RRI(S)
25NC96BGTA5RRI(R)RRRRRRI(S)I(R)RSR
8Feng Kang 10RIRIRRRRRSI(S)SSS
noneAmphiploidI(S)SSSSSSSSSSSSS
noneLine 9SSSSI(S)SSSSSSSSS
8Line 26RI(S)RRRRRSISSSSS
noneTrans 1SSSSSSI(S)SSSI(S)SSS
86HRSWN125RRRRRRRRRSI(S)SSS
noneChancellorSSSSSSSISSSSSS
Tab.3  Differential reactions of 15 wheat cultivars/lines possessing known powdery mildew resistance genes or without powdery mildew resistance genes, and five wheat cultivars/lines tested after inoculation with 14 isolates of f. sp.
wheat groupGwmGdmWmcBarcWem
testedpolymorphictestedpolymorphictestedpolymorphictestedpolymorphictestedpolymorphic
123110032760
250090919060
3463602114073
420080314070
53221701112071
63101002013161
7110602011060
unknown1
total2136750227701455
Tab.4  Number of microsatellite loci used to screen , amphiploid, Chinese Spring, and Feng Kang 7, 10, and 13, and the number of SSRs with polymorphism between and
Fig.2  Wem 50, Wmc 27, and Gwm 156 produced the specific fragments of 360, 270, and 160-180 bp, respectively (indicated by arrow), only with
Note: A, B, and C represent Wem50, Wmc 27, and Gwm156, respectively, applied to CS (Lane 1), (Lane 2), amphiploid (Lane 3), Feng Kang 10 (Lane 4), and Feng Kang 13 (Lane 5). M means DNA ladders.
SSRGwm 497Wmc 44Wmc 51Wmc 154Gwm 369Gwm 391Wmc 153Gwm 264Wem 22Wem 26Wem 32Wmc 48Gwm 156Gwm 291Wmc 327Wem 45Barc 21Wem 50Wmc 27
groups1A1B1B2B3A3A3A3B3L3S3S4B5A5A5A5L6B6Sunknown
CS-a------------------
FK10-------------------
amphiploid---+--+--+------+--
Leymus+ b++++++++++++++++++
Trans1-----+-----+----+--
Trans2-----+---+-+----+--
Trans3-----+-----+----+--
Line4-------+-+------+--
Line5-------------------
Line6-+--+-++-----------
Line7-+-----------------
Line9-+-----------------
Line10-+-----------------
Line11-+-----------------
Line12-+-----------------
Line14------------+---+--
Line15-+----++-+------+--
Line16+-+----------------
Line18-++----------------
Line20-------------------
Line22-------------------
Line23-------------------
Line24----------------+--
Line25-------------------
Line26---------+------+--
Line27-++---------+------
Line28-------------------
Line29------+-------+-+--
Tab.5  Homeology of the chromosomes added to common wheat identified by SSRs showed polymorphism between and wheat
Fig.3  Gwm264 produced a specific fragment (140 bp) with but not with amphiploid (A). Wem26 produced a specific fragment (650 bp) with and the amphiploid (B). Gwm264 (A) and Wem 26 (B) applied to Feng Kang 10 (Lane 1), Amphiploid (Lane 2), (Lane 3), CS (Lane 4), Translocation Trans 1 (Lane 5), Translocation Trans 2 (Lane 6), Translocation Trans 3 (Lane 7), Line 4 (Lane 8), Line 5 (Lane 9), Line 6 (Lane 10), Line 7 (Lane 11), Line 9 (Lane 12), Line 10 (Lane 13), Line 11 (Lane 14), Line 12 (Lane 15), Line 14 (Lane 16), Line 15 (Lane 17), Line 16 (Lane 18), Line 18 (Lane 19), Line 20 (Lane 20), Line 22 (Lane 21), Line 23 (Lane 22), Line 24 (Lane 23), Line 25 (Lane 24), Line 26 (Lane 25), Line 27 (Lane 26), Line 28 (Lane 27), and Line 29 (Lane 28). M stands for DNA ladder.
Fig.4  Lower transmission in wheat plants with an added chromosome (21 II + I )
1 Anderson J M, Bucholtz D L, Greene A E, Francki M G, Gray S M, Sharma H, Ohm H W, Perry K L (1998). Characterization of wheatgrass-derived barley yellow dwarf virus resistance in a wheat alien chromosome substitution line. Phytopathology , 88(8): 851–855
doi: 10.1094/PHYTO.1998.88.8.851
2 Ayala L, Hery M, González-de-León D, van Ginkel M, Mujeeb-Kazi A, Keller B, Khairallah M (2001). A diagnostic molecular markers allowing the study of Th. Intermedium-derived resistance to BYDV in bread wheat segregating populations. Theor Appl Genet , 102(6-7): 942–949
3 Bai G H, Shannar G (1994). Scab of wheat: prospects for control. Plant Dis , 78(88): 760–766
4 Brettell R I S, Banks P M, Cauderon Y, Chen X, Cheng Z M, Larkin P J, Waterhouse P M (1988). A single wheatgrass chromosome reduces the concentration of barley yellow dwarf virus in wheat. Ann Appl Biol , 113(3): 599–603
doi: 10.1111/j.1744-7348.1988.tb03337.x
5 Clark M F, Adams A N (1977). Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol , 34(3): 475–483
doi: 10.1099/0022-1317-34-3-475
6 Conti M D, Arcy C J, Jedlinski H (1990). The “yellow plague” of cereals, barley yellow dwarf virus. In: Burnett P A, ed. World Perspectives on Barley Yellow Dwarf Virus . Mexico: CIMMYT, 1–6
7 Devos K M, Millan T, Gale M D (1993). Comparative RFLP maps of homoeologous group 2 chromosomes of wheat, rye and barley. Theor Appl Genet , 85: 784–792
8 Dewey D R (1984). The genome system of classification as a guide to intergeneric hybridization with perennial Triticeae. In: Gustafson J P, ed. Gene Manipulation in Plant Improvement . New York: Plenum Press, 209–279
9 Dong Y S (1986). Study on hybridization of Triticum aestivum with Leymus multicaulis and Leymus racemosus. First Inter Symp Chromosome Engineerings. P1, Xi’an : 185–187
10 Dubcovsky J, Luo M C , Zhong G Y, Bransteitter R, Desai A J, Kilian A, Kleinhofs A, Dvorák J (1996). Genetic map of diploid wheat, Triticum monococcum L., and its comparison with maps of Hordeum vulgare L. Genetics , 143(2): 983–999
11 Flor H H (1955). Host-parasite interaction in flax rust-its genetics and other implications. Phytopathology , 45: 680–685
12 Friebe B, Jiang J, Raupp W J, McIntosh R A, Gill B S (1996). Characterization of wheat-alien translocations conferring resistance to diseases and pests: current status. Euphytica , 91(1): 59–87
doi: 10.1007/BF00035277
13 Gill K S, Lubbers E L, Gill B S, Raupp W J, Cox T S (1991). A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome , 34(3): 362–374
14 Gupta K, Balyan S, Edwards J, Isaac P, Korzun V, R?der M S, Gautier M F, Joudrier P, Schlatter R, Dubcovsky J, De La Pena C, Khairallah M, Penner G, Hayden J, Sharp P, Keller B, Wang C, Hardouin P, Jack P, Leroy P (2002). Genetic mapping of 66 new microsatellite (SSR) loci in bread wheat. Theor Appl Genet , 105(2-3): 413–422
15 Hammond J, ListerR M , Foster J E (1983). Purification, identity and some properties of an isolate of barley yellow dwarf virus from Indiana. J Gen Virol , 64(3): 667–676
doi: 10.1099/0022-1317-64-3-667
16 Jia J, Zhou R, Li P, Zhao M, Dong Y (2002). Identifying the alien chromosomes in wheat-Leymus multicaulis derivatives using GISH and RFLP techniques. Euphytica , 127(2): 201–207
doi: 10.1023/A:1020262723618
17 Jiang J, Gill B S (1994). Nonisotopic in situ hybridization and plant genome mapping: the first 10 years. Genome , 37(5): 717–725
18 Kong L, Anderson J M, Ohm H W (2005a). Induction of wheat defense and stress-related genes in response to Fusarium graminearum. Genome , 48(1): 29–40
doi: 10.1139/g04-097
19 Kong L, Ohm H W, Cambron S E, Williams C E (2005b). Molecular mapping determines that Hessian fly resistance gene H9 is located on chromosome 1AS of wheat. Plant Breed , 124(6): 525–531
doi: 10.1111/j.1439-0523.2005.01139.x
20 Leath S, Heun M (1990). Identification of powdery mildew resistance genes in cultivars of soft red winter wheat. Plant Dis , 74(10): 747–752
doi: 10.1094/PD-74-0747
21 Liu J Q, Kolmer J A (1998). Genetics of stem rust resistance in wheat cvs. Pasqua and AC Taber. Phytopathology , 88(2): 171–176
doi: 10.1094/PHYTO.1998.88.2.171
22 Mujeeb-Kazi A, Bernard M, Bekele G T, Mirand J L (1983). Incorporation of alien genetic information from Elymus giganteus into Triticum aestivum. In: Sakamoto S, ed. Proc 6th Int Wheat Genet Symp . Kyoto: Maruzen, 223–231
23 Mullan D J, Platteter A, Teakle N L, Appels R, Colmer T D, Anderson J M, Francki M G (2005). EST-derived SSR markers from defined regions of the wheat genome to identify Lophopyrum elongatum specific loci. Genome , 48(5): 811–822
24 Ohm H W, Anderson J M, Sharma H C, Ayala L, Thompson N, Uphaus J J (2005). Registration of yellow dwarf viruses resistant wheat germplasm line P961341. Crop Sci , 45: 805–806
doi: 10.2135/cropsci2005.0805
25 Peil A, Korzun V, Schubert V, Schemann E, Weber W E, R?der M S (1998). The application of wheat microsatellites to identify disomic Triticum aestivum-Aegilops markgrafii addition lines. Theor Appl Genet , 96(1): 138–146
doi: 10.1007/s001220050720
26 Peng J H, Lapitan N L V (2005). Characterization of EST-derived microsatellites in the wheat genome and development of eSSR markers. Funct Integr Genomics , 5(2): 80–96
doi: 10.1007/s10142-004-0128-8
27 Pestsova E, Ganal M W, R?der M S (2000). Isolation and mapping of microsatellite markers specific for the D genome of bread wheat. Genome , 43(4): 689–697
doi: 10.1139/gen-43-4-689
28 Plourde A, Comeau A, Fedak G, St-Pierre C A (1989). Intergeneric hybrids of Triticum aestivum × Leymus multicaulis. Genome , 32(2): 282–287
29 Plourde A, Comeau A, St-Pierre C A (1992). Barley yellow dwarf virus resistance in Triticum aestivum × Leymus angustus hybrids. Plant Breed , 108(2): 97–103
doi: 10.1111/j.1439-0523.1992.tb00107.x
30 Qi L L, Wang S L, Chen P D, Liu D J, Friebe B, Gill B S (1997). Molecular cytogenetic analysis of Leymus racemosus chromosomes added to wheat. Theor Appl Genet , 95(7): 1084–1091
doi: 10.1007/s001220050666
31 R?der M S, Korzun V, Wendehake K, Plaschke J, Tixier M H, Leroy P, Ganal M W (1998). A microsatellite map of wheat. Genetics , 149(4): 2007–2023
32 R?der M S, Plaschke J, K?nig S U, B?rner A, Sorrells M E, Tanksley S D, Ganal M W (1995). Abundance, variability and chromosomal location of microsatellites in wheat. Mol Gen Genet , 246(3): 327–333
doi: 10.1007/BF00288605
33 Saghai Maroof M A, Biyashev R M, Yang G P, Zhang Q, Allard R W (1994). Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proc Natl Acad Sci USA , 91(12): 5466–5470
doi: 10.1073/pnas.91.12.5466
34 Sharma D, Knott D R (1966). The transfer of leaf-rust resistance from Agropyron to Triticum by irradiation. Can J Genet Cytol , 8(1): 137–143
35 Shen X, Kong L, Ohm H (2004). Fusarium head blight resistance in hexaploid wheat (Triticum aestivum)-Lophopyrum genetic lines and tagging of the alien chromatin by PCR markers. Theor Appl Genet , 108(5): 808–813
doi: 10.1007/s00122-003-1492-9
36 Srnic G, Murphy J P, Lyerly J H, Leath S, Marshall D S (2005). Inheritance and chromosomal assignment of powdery mildew resistance genes in two winter wheat germplasm lines. Crop Sci , 45(4): 1578–1586
doi: 10.2135/cropsci2004.0530
37 Stakman E C, Stewart D M, Loegering W Q (1962). Identification of physiological races of Puccinia graminis var. tritici. US Dep Agric. ARS E , 617: 1–53
38 Wang X E, Chen P D, Liu D J, Zhang P, Zhou B, Friebe B, Gill B S (2001). Molecular cytogenetic characterization of Roegneria ciliaris chromosome in common wheat. Theor Appl Genet , 102(5): 651–657
doi: 10.1007/s001220051693
39 Zhang Z Y, Xu J S, Xu Q J, Larkin P, Xin Z Y (2004). Development of novel PCR markers linked to the BYDV resistance gene Bdv2 useful in wheat for marker-assisted selection. Theor Appl Genet , 109(2): 433–439
doi: 10.1007/s00122-004-1649-1
[1] Daling FENG, Shuxin XUAN, Aixia GU, Airu MA, Jiuhuan LI, Shuxing SHEN. PCR-based screening of BAC clones of different chromosomes in Chinese cabbage[J]. Front Agric Chin, 2011, 5(4): 524-528.
[2] Wenjing LU, Jincai LI, Fangpeng LIU, Juntao GU, Chengjin GUO, Liu XU, Huiyan ZHANG, Kai XIAO. Expression pattern of wheat miRNAs under salinity stress and prediction of salt-inducible miRNAs targets[J]. Front Agric Chin, 2011, 5(4): 413-422.
[3] Xirong CUI, Yongsheng ZHANG, Fanghua ZHAO, Chengjin GUO, Juntao GU, Wenjing LU, Xiaojuan LI, Kai XIAO. Molecular characterization and expression analysis of phosphate transporter gene TaPT2-1 in wheat (Triticum aestivum L.)[J]. Front Agric Chin, 2011, 5(3): 274-283.
[4] Xinyan WEI, Lifeng LIU, Shunli CUI, Huanying CHEN, Jingjing ZHANG. Development of EST-SSR markers in peanut (Arachis hypogaea L.)[J]. Front Agric Chin, 2011, 5(3): 268-273.
[5] Chengjin GUO, Jincai LI, Wensuo CHANG, Lijun ZHANG, Xirong CUI, Shuwen LI, Kai XIAO. Effects of chromosome substitution on the utilization efficiency of nitrogen, phosphorus, and potassium in wheat[J]. Front Agric Chin, 2011, 5(3): 253-261.
[6] Muhammad Shahzad AHMED, Ihsan KHALIQ, Jehanzeb FAROOQ, Shahid Iqbal AWAN, Nisar AHMED, Faisal Saeed AWAN. Assessment of the combining ability and authentication of F1 hybrids using SSR markers in wheat (Triticum aestivum L.)[J]. Front Agric Chin, 2011, 5(2): 135-140.
[7] Zhongxu LIN, Daojun YUAN, Xianlong ZHANG, . Mapped SSR markers unevenly distributed on the cotton chromosomes[J]. Front. Agric. China, 2010, 4(3): 257-264.
[8] Jiaqing WANG, Lin HOU, . Unigene derived SSR analysis for the Fugu rubripes and insights into the characteristics of EST-SSR distribution in tissues/organs[J]. Front. Agric. China, 2010, 4(1): 121-127.
[9] Kai WEI, Hao ZHANG, Xianfeng XU, Zuxin ZHANG, Hewei DU, Yiqin HUANG, . Evaluation of phenotype and genetic diversity of maize landraces from Hubei Province, Southwest China[J]. Front. Agric. China, 2009, 3(4): 374-382.
[10] PAN Zhifen, LONG Hai, YU Maoqun, DENG Guangbing, ZHAI Xuguang, TANG Yawei, QIANG Xiaolin. Molecular analysis of cultivated naked barley ( L.) from Qinghai-Tibet Plateau in China using SSR markers[J]. Front. Agric. China, 2008, 2(4): 372-379.
[11] YAO Yuxin, ZHAI Heng, ZHAO Lingling, YI Kai, LIU Zhi, SONG Ye. Analysis of the apple fruit acid/low-acid trait by SSR markers[J]. Front. Agric. China, 2008, 2(4): 463-466.
[12] LI Zhikun, WANG Xingfen, ZHANG Yan, ZHANG Guiyin, WU Liqiang, CHI Jina, Zhiying MA. Assessment of genetic diversity in glandless cotton germplasm resources by using agronomic traits and molecular markers[J]. Front. Agric. China, 2008, 2(3): 245-252.
[13] CHEN Fabo, YANG Kecheng, RONG Tingzhao, PAN Guangtang. Analysis of genetic diversity of maize hybrids in the regional tests in Sichuan and Southwest China[J]. Front. Agric. China, 2008, 2(2): 162-171.
[14] YIN Jing, WANG Guangjin, MA Fengming, ZHANG Hongji, XIAO Jialei, SUN Yan, DIAO Yanling, HUANG Jinghua, GUO Qiang. Genetic analysis and SSR mapping of stem rust resistance gene from wheat mutant D51[J]. Front. Agric. China, 2008, 2(2): 131-136.
[15] WANG Xingfen, MA Jun, YANG Shuo, ZHANG Guiyin, MA Zhiying. Assessment of genetic diversity among Chinese upland cottons with Fusarium and/or Verticillium wilts resistance by AFLP and SSR markers[J]. Front. Agric. China, 2007, 1(2): 129-135.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed