Please wait a minute...
Frontiers of Agriculture in China

ISSN 1673-7334

ISSN 1673-744X(Online)

CN 11-5729/S

Front Agric Chin    2010, Vol. 4 Issue (4) : 494-500     DOI: 10.1007/s11703-010-1047-1
RESEARCH ARTICLE |
Effects of folic acid supplementation on growth performance and hepatic folate metabolism-related gene expressions in weaned piglets
Bing YU1,2, Guangbo YANG1,2, Jingbo LIU1,2, Daiwen CHEN1,2()
1. Key Laboratory for Animal Nutrition of Disease Resistance, Ya’an 625014, China; 2. Animal Nutrition Institute, Sichuan Agricultural University, Ya’an 625014, China
Download: PDF(131 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

The present study was conducted to evaluate the effects of different folic acid supplemental levels on growth performance, serum biochemical indicators, and hepatic folate metabolism-related gene expressions in weaned piglets. There were 160 piglets with initially average bodyweight of 7.33 kg randomly assigned to diets containing five levels of folic acid: basal diets (C), 0.5 mg·kg-1 folic acid (FS 0.5), 2.5 mg·kg-1 folic acid (FS 2.5), 5.0 mg·kg-1 folic acid (FS 5.0), or 10.0 mg·kg-1 folic acid (FS 10.0). Blood samples were collected from a subset (n = 20; 4 pigs per treatment) of the piglets on day 0, 14, and 28. Liver samples were collected from the blood-taken piglets on day 28 of the experiment. Pigs fed basal diet supplemented with 2.5 mg·kg-1 folic acid grew faster (P<0.05) and consumed more feed (P<0.01) than groups of C, FS 5.0, and FS 10.0 during the last two weeks. Dietary treatment had no effect on F/G throughout the experiment. Pigs in the FS 2.5 group showed greater concentrations of Growth Hormone (GH) (P<0.05) and Insulin-like Growth Factors (IGF-1) (P<0.01) in serum than C and FS 10.0 on day 28. RT-PCR analysis revealed that FS 0.5, FS 2.5, and FS 5.0 had a greater abundance of the mRNA encoding 5,10-methylenetetrahydrofolate reductase than C and FS 10.0 (P<0.01). The mRNA expressions of folate binding protein in FS 0.5 and FS 2.5 were upregulated compared with pigs fed with basal diet (P<0.05). These results demonstrated that folate supplemental level of 2.5 mg·kg-1 significantly enhanced the growth performance of piglets. Folic acid had an impact on folate metabolism and the homocysteine concentrations. No folate supplementation or folate supplemental level of 10 mg·kg-1 could not increase the growth performance to the greatest degree.

Keywords folic acid      growth performance      folate binding protein (FOLBP)      5,10-methylenetetrahydrofolate reductase (MTHFR)      piglets     
Corresponding Authors: CHEN Daiwen,Email:daiwenc@yahoo.com   
Issue Date: 05 December 2010
URL:  
http://academic.hep.com.cn/fag/EN/10.1007/s11703-010-1047-1     OR     http://academic.hep.com.cn/fag/EN/Y2010/V4/I4/494
itemphase 1 (week 1-2)phase 2 (week 3-4)
ingredient/%
corn46.5052.70
soybean oil4.254.10
extruded soybean13.0017.00
fish meal4.504.00
plasma protein6.003.00
fermented soybean meal4.205.00
vitamin-mineral premix11.001.00
limestone0.600.70
sodium chloride0.460.32
dicalcium phosphate0.700.70
whey powder15.009.00
white sugar3.002.00
L-lysine HCl0.470.30
DL-methionine0.210.07
L-threonine0.270.13
zinc oxide0.300.30
calculated analysis/%
crude protein20.0618.99
metabolic energy/ Mcal·kg-13.3983.399
Ca0.740.71
total P0.590.58
available P0.420.39
lysine1.601.35
methionine0.530.40
methionine+ cystine0.800.67
threonine1.040.86
folic acid (determined)0.48/mg·kg-10.41/mg·kg-1
Tab.1  Composition and nutrient levels of basal diets (air-dry basis, %)
geneprimer sequences (5′-3′)annealing temperature/°Cproduct Tmproduct size/bpGenBank accession no.
MTHFRF: AGACCATACTGCACATGACCTG59.778.5155AF239166
R: GTAGCTGAAGCCTCCTTCCTC
FOLBPF: TTGAGTCCTTCTTCCCCACAC5688152NM_213853.1
R: GAACCTCGCTACCTCCTCGTT
H2AF:TGGATGTCCTTGGGCATG60.191.5226BP459633
R: AGATCCGGCGCTACCAGA
Tab.2  Primers used for PCR and nested PCR for detection of , , and position on cDNA
itemlevels of folic acid
1CFS 0.5FS 2.5FS 5.0FS 10.0
ADG/g
Phase 1242.63±20.79243.30±18.07263.62±20.06245.98±29.89242.97±15.32
Phase 2459.26±41.05b487.72±25.57ab522.32±16.03a463.39±39.34b461.50±22.94b
week 1 to 4350.95±27.21b365.51±21.08ab392.97±21.32a354.69±28.88ab352.23±11.45b
ADFI/g
Phase 1314.82±23.26315.87±9.21325.04±29.60308.92±28.40309.37±9.15
Phase 2692.08±39.89c717.44±21.73ac761.98±22.46a694.02±47.99c693.08±19.19c
week 1 to 4503.45±29.46516.66±14.73543.51±21.77501.47±37.83501.22±29.72
feed:gain/ g/g
Phase 11.29±0.121.30±0.071.24±0.041.26±0.041.28±0.05
Phase 21.51±0.051.47±0.041.46±0.031.50±0.071.50±0.04
week 1 to 41.44±0.041.42±0.051.38±0.031.42±0.051.43±0.03
BW/kg
initial7.320±0.697.325±0.677.325±0.737.331±0.737.361±0.64
week 417.147±1.3917.559±1.1518.328±1.7817.263±1.6917.223±1.38
Tab.3  Effects of different levels of dietary folic acid on growth performance of weaned pigs
itemlevels of folic acid
CFS 0.5FS 2.5FS 5.0FS 10.0
GH/g·L-1
days of postweaning
01.22±0.041.26±0.031.23±0.061.25±0.061.26±0.11
141.39±0.081.48±0.121.48±0.101.46±0.151.43±0.06
281.48±0.12b1.57±0.08ab1.59±0.17a1.51±0.07ab1.49±0.05b
IGF-1/ng·mL-1
days of postweaning
087.65±6.1888.65±3.4689.29±4.0388.66±4.5189.97±2.56
14105.46±14.65b113.86±16.42ab117.94±11.19a113.34±15.37ab106.71±10.32b
28130.95±16.90c148.27±17.90ab151.18±15.38a143.00±11.98abc132.36±16.72c
INS/IU·L-1
days of postweaning
021.40±1.6921.94±1.7122.02±2.1623.15±1.8021.65±2.00
1429.94±1.9130.76±1.6131.25±0.4331.42±0.9730.35±0.83
2832.06±1.9034.61±1.6133.95±1.2733.76±1.5533.99±2.77
creatinine/mol·L-1
days of postweaning
094.73±10.1496.68±9.0997.27±11.8296.51±9.8998.52±9.15
1487.96±9.5986.90±9.6085.36±10.2084.74±8.4785.94±9.93
2878.82±9.0783.79±8.4480.63±9.3979.50±8.5480.18±10.26
alkaline phosphatase/U·L-1
days of postweaning
0334.60±40.57347.23±24.68333.58±35.55342.07±39.42348.28±29.58
14287.13±22.68293.05±34.58294.45±21.88296.10±31.99305.18±32.64
28293.15±22.33303.18±32.09307.58±35.63302.48±37.56302.53±26.37
Tab.4  Effects of levels of folate on serum biochemical indicators of weanling pigs
Fig.1  Serum folic acid concentrations in piglets in response to different folate supplemental levels
Fig.2  Serum homocysteine concentrations in piglets in response to different folate supplemental levels
Fig.3  Effect of folate supplemental levels on the relative expression of gene in livers of piglets
Note: The transcript expression level of was higher (<0.05) in FS 0.5 and FS 2.5 than C. Data are presented in mean±SD. Different small letters denote statistical differences between groups (<0.05).
Fig.4  Effect of folate supplemental levels on the relative expression of gene in livers of piglets
Note: Higher (<0.01) expression was observed in FS 0.5, FS 2.5, and FS 5.0 than C and FS 10.0. Data are presented in mean±SD. Different small letters denote statistical differences between groups (<0.05).
1 Achón M, Reyes L, Alonso-Aperte E, úbeda N, Varela-Moreiras G (1999). High dietary folate supplementation affects gestational development and dietary protein utilization in rats. The Journal of Nutrition , 129: 1204-1208
2 Ashokkumar B, Mohammed Z M, Vaziri N D, Said H M (2007). Effect of folate oversupplementation on folate uptake by human intestinal and renal epithelial cells. American Journal of Clinical Nutrition , 86: 159-166
3 Bailey L B, Gregory J F (1999). Polymorphisms of methylenetetrahydrofolate reductase and other enzymes: metabolic significance, risks and impact on folate requirements. The Journal of Nutrition , 129: 919-922
4 Birn H (2006). The kidney in vitamin B12 and folate homeostasis: characterization of receptors for tubular uptake of vitamins and carrier proteins. American Journal of Physiology , 291: F22-F36
doi: 10.1152/ajprenal.00385.2005
5 Easter R A, Anderson P A, Michel E J, Corley J R (1983). Response of gestating gilts and starter grower and finisher swine to biotin pyridoxine folacin and thiamine additions to a corn-soybean meal diet. Nutrition Reports International , 28: 945-953
6 Homocysteine Lowering Trialists’ Collaboration (2005). Dose-dependent effects of folic acid on blood concentrations of homocysteine: a meta-analysis of the randomized trials. American Journal of Clinical Nutrition , 82: 806-812
7 Le Greves M, Steensland P, Le Greves P, Nyberg F (2002). Growth hormone induces age-dependent alteration in the expression of hippocampal growth hormone receptor and N-methyl-D-aspartate receptor subunits gene transcripts in male rats. Proceedings of the National Academy of Sciences of the United States of America , 99: 7119-7123
doi: 10.1073/pnas.092135399
8 Lévesque J, Girard C L, Matte J J, Brisson G J (1993). Dietary supplements of folic acid: blood and growth responses of white veal calves. Livestock Production Science , 34: 71-82
doi: 10.1016/0301-6226(93)90036-H
9 Lindemann M D, Kornegay E T (1986). Folic acid additions to weanling pig diets. Journal of Animal Science , 63 (Suppl 1): 35 (Abstr)
10 Lucock M (2000). Folic acid: nutritional biochemistry, molecular biology, and role in disease processes. Molecular Genetics and Metabolism , 71:121-138
doi: 10.1006/mgme.2000.3027
11 Matte J J, Girard C L, Tremblay G F (1993). Effect of long-term addition of folic acid on folates status, growth performance, puberty attainment, and reproductive capacity of gilts. Journal of animal scicence , 71: 151-157
12 Matthews R G, Baugh C M (1980). Interactions of pig liver methylenetetrahydrofolate reductase with methylenetetrahydropteroylpolyglutamate substrates and with dihydropteroylpolyglutamate inhibitors. Biochemistry , 19: 2040-2045
doi: 10.1021/bi00551a005
13 Newcomb M D, Allee G L (1986). Water-soluble vitamins for weanling pigs. Journal of Animal Science , 63 (Suppl 1): 108 (Abstr)
14 Niculescu M D, Zeisel S H (2002). Diet, methyl donors and DNA methylation: Interactions between dietary folate, methionine and choline. The Journal of Nutrition , 132: 2333S-2335S
15 Rosenquist T H, Schneider A M, Monaghan D T (1999). N-methyl-D-aspartate receptor agonists modulate homocysteine-induced developmental abnormalities. Journal of the Federation of American Societies for Experimental Biology , 13: 1523-1531
16 Sesmilo G, Biller B M, Llevadot J, Hayden D, Hanson G, Rifai N, Klibanski A (2001). Effects of growth hormone (GH) administration on homocyst(e)ine levels in men with GH deficiency: a randomized controlled trial. Journal of Clinical Endocrinology &amp; Metabolism , 86: 1518-1524
doi: 10.1210/jc.86.4.1518
17 Stern F, Berner Y N, Polyak Z, Komarnitsky M, Sela B A, Hopp M, Dror Y (2004). Homocysteine effect on protein degradation rates. Clinical Biochemistry , 37: 1002-1009
doi: 10.1016/j.clinbiochem.2004.07.011
18 Villanueva J, Ling E H, Chandler C J, Halsted C H (1998). Membrane and tissue distribution of folate binding protein in pig. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology , 275: 1503-1510
[1] Baojiang CHEN, Yong WANG, Huimin YU, Qing XU. Effects of aflatoxin-detoxifizyme on growth performance and liver biochemical indices of broilers fed with aflatoxin B1[J]. Front Agric Chin, 2011, 5(4): 594-597.
[2] TANG Zhonglin, LI Kui, PENG Zhongzhen, LIU Bang, FAN Bin, ZHAO Shuhong, LI Xiaoping, XU Sanping. Effect of breed, sex and birth parity on growth, carcass and meat quality in pigs[J]. Front. Agric. China, 2008, 2(3): 331-337.
[3] LI Jianwen, CHEN Daiwen, ZHANG Keying, LONG Dingbiao. The effect of immune stress on ideal amino acid pattern for piglets[J]. Front. Agric. China, 2007, 1(2): 210-213.
[4] SUN Bin, ZHANG Keying, ZENG Qiufeng, WANG Cairong. Effects of ascites syndrome in broilers on their growth performances and the availability of energy and nutrients[J]. Front. Agric. China, 2007, 1(2): 220-223.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed