Please wait a minute...
Frontiers of Agriculture in China

ISSN 1673-7334

ISSN 1673-744X(Online)

CN 11-5729/S

Front Agric Chin    2011, Vol. 5 Issue (2) : 209-214     DOI: 10.1007/s11703-011-1073-7
RESEARCH ARTICLE |
Genomic organization and sequence polymorphism of a farnesyl diphosphate synthase gene in apples (Malus domestica Borkh.)
Kejun YUAN(), Lixiang Huang, Chengxiang AI, Hairong WEI, Qingzhong LIU
Shandong Institute of Pomology, Taian 271000, China
Download: PDF(135 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

Primer pairs were designed to amplify the genomic DNA sequence of the farnesyl diphosphate synthase (FPPS) gene by PCR. The PCR products were sequenced, spliced and compared to the cDNA sequence in the GenBank (accession No. AY083165). The genomic sequence and intron-exon organization of FPPS1 gene in the apple cultivar ‘Fuji’ were thus obtained. The FPPS1 genomic sequence has been registered in the GenBank (accession No. HM545312). It has 11 introns and 12 exons. The sizes of 11 introns were 559 bp, 108 bp, 144 bp, 114 bp, 84 bp, 690 bp, 373 bp, 168 bp, 87 bp, 91 bp and 97bp, and their phases were 0, 1, 0, 0, 0, 2, 0, 0, 0, 0 and 0, respectively. The sizes of 12 exons were 111 bp, 25 bp, 116 bp, 87 bp, 117bp, 89 bp, 52 bp, 96 bp, 45 bp, 90 bp, 72 bp and>12 bp, respectively. Gene sequence comparison results of five apple cultivars indicated that the development of apple superficial scald was not influenced by the mutations in the exon sequence of FPPS1 gene. A 6-bp repeat unit deletion mutation and many SNP mutations in the introns, mainly in the introns of one allele, were identified in the apple scald-resistant cultivar ‘Golden Delicious’. This is the first report on the genomic organization and coding region polymorphism of FPPS gene in apples and other fruit trees.

Keywords apple      farnesyl diphosphate synthase      genomic DNA      polymorphism      superficial scald     
Corresponding Authors: YUAN Kejun,Email:yuankj@vip.sina.com   
Issue Date: 05 June 2011
URL:  
http://academic.hep.com.cn/fag/EN/10.1007/s11703-011-1073-7     OR     http://academic.hep.com.cn/fag/EN/Y2011/V5/I2/209
PCR productForward primerReverse primer
f5-6f5: ACATCTCTCTCCCTCTCTGf6: ATCTTCAGTTAATTCCCTTC
f7-8af7: GGATTGTCTGTTATTGACAGf8a: ATAGGAAACAGCATACAGG
f9-10zf9: GTGGAATTTCAAACTGCCf10z: CCAAAGCAATCCAAATAATC
f9h-10zf9h: CCAAACAGTCTAAACAGCTTGf10z: CCAAAGCAATCCAAATAATC
f9h-10zf10k: AGACCAAGGGAGTTATGTACTG
f9v-10vf9v: TGAATACACAGAAACAGAATCCf10v: CGCAAATACACCCTACCAC
f9v-10vf9u: CCTCCGCACAATGGAACTC
f9-f10pf9: GTGGAATTTCAAACTGCCf10p: GACATCAATAGAGAATCAC
f9-f10qf9: GTGGAATTTCAAACTGCCf10q: AAGTAAACATGCTGGTGTG
f9p-10kf9p: CGATGCTGCAGAAAAGCACf10k: AGACCAAGGGAGTTATGTACTG
Tab.1  PCR products and related primers
Fig.1  Genomic organization of farnesyl diphosphate synthase gene in the apple cultivar ‘Fuji’.
Fig.2  The position of 5 motifs in the deduced amino acid sequence of apple farnesyl diphosphate synthase gene.
Fig.3  The mutations in the sequences of the gene and its deduced amino acid. Numbers in the boxes indicate the positions in the exon part of gene in the apple cultivar ‘Fuji’.
Intron No.Position in each intronNucleotide in ‘Fuji’Nucleotide in GDAllele no.Intron No.Position in each intronNucleotide in ‘Fuji’Nucleotide in GDAllele no.
No.1No.2No.1No.2
No.1230GG/A(G)(A)No.6180GG/TGT
246TC/T(T)(T)201CC/GCG
262TTACTA/(deletion)//285ACCC
No.210TT/C(T)(C)288GG/AGA
17GG/A(G)(A)337TT/CTC
No.387GTTT400TT/ATA
117TCCC402TT/CTC
No.611/A(insertion)AA443TT/GTG
50TT/CTC490TT/CTC
58GG/AGA589AA/GAG
88TT/CTC605AA/CAC
89GG/AGA617TT/ATA
99TT/CTC619GG/AGA
138TT/CTCNo.795TC/TTC
139AA/GAGNo.849TA/T(T)(A)
141TT/ATA66CAAA
143GG/AGA155CTTT
168GA/GGANo.118TCCC
170AGGG
Tab.2  Mutations in the introns of gene
1 Beuning L, Green S, Yauk Y K (2010). The genomic sequence of AFS-1-an alpha-farnesene synthase from the apple cultivar ‘Royal Gala’. Front Agric China , 4(1): 74–78
doi: 10.1007/s11703-009-0091-1
2 Chen J, Wang Z Y (2004). Expression of OsBP-73 gene requires the involvement of its intron in rice. J Plant Physiol Mol Biol , 30(1): 81–86 (in Chinese)
pmid:15583413
3 Chen K S, Li F, Xu C J, Zhang S L, Fu C X (2004). An efficient macro-method of genomic DNA isolation from Actinidia chinensis leaves. Hereditas(Beijing) , 26(4): 529–531 (in Chinese)
pmid:15640056
4 Cunillera N, Arró M, Delourme D, Karst F, Boronat A, Ferrer A (1996). Arabidopsis thaliana contains two differentially expressed farnesyl-diphosphate synthase genes. J Biol Chem , 271(13): 7774–7780
doi: 10.1074/jbc.271.13.7774 pmid:8631820
5 Green S, Friel E N, Matich A, Beuning L L, Cooney J M, Rowan D D, MacRae E (2007). Unusual features of a recombinant apple α-farnesene synthase. Phytochemistry , 68(2): 176–188
doi: 10.1016/j.phytochem.2006.10.017 pmid:17140613
6 Guan W Q, Chen L, Li X H, Hu Y F (2004). Effect of modified atmosphere packaging on the quality of Fuji apple. Transactions of the CSAE , 20(5): 218–221 (in Chinese)
7 Ju Z G, Curry E A (2000). Lovastatin inhibits α-farnesene synthesis without affecting ethylene production during fruit ripening in ‘Golden Supereme’ apples. J Am Soc Hortic Sci , 125(1): 105–110
8 K?llner T G, Schnee C, Gershenzon J, Degenhardt J (2004). The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes. Plant Cell , 16(5): 1115–1131
doi: 10.1105/tpc.019877 pmid:15075399
9 Kuhnlein U, Ni L, Weigend S, Gavora J S, Fairfull W, Zadworny D (1997). DNA polymorphisms in the chicken growth hormone gene: response to selection for disease resistance and association with egg production. Anim Genet , 28(2): 116–123
doi: 10.1111/j.1365-2052.1997.00076.x pmid:9172309
10 Li M, Sui N, Zhang Y H, Meng Q W (2006). Cloning and prokaryotic expression of apple AFS gene. Acta Horticulturae Sinica , 33(1): 122–124 (in Chinese)
11 Li R, Wang Z Z (2007). A bioinformatics analyses on farnesyl diphosphate synthase. J Tropical Subtropical Botany , 15(2): 126–134 (in Chinese)
12 Pechous S W, Watkins C B, Whitaker B D (2005). Expression of αα-farnesene synthase gene AFS1 in relation to levels of α-farnesene and conjugated trienols in peel tissue of scald-susceptible ‘Law Rome’ and scald-resistant ‘Idared’ apple fruit. Postharvest Biol Technol , 35(2): 125–132
doi: 10.1016/j.postharvbio.2004.08.005
13 Pechous S W, Whitaker B D (2002). Cloning and bacterial expression of a 3-hydroxy-3-methylglutaryl-CoA reductase cDNA (HMG1) from peel tissue of apple fruit. J Plant Physiol , 159(8): 907–916
doi: 10.1078/0176-1617-00806
14 Pechous S W, Whitaker B D (2004). Cloning and functional expression of an (E, E)-α-farnesene synthase cDNA from peel tissue of apple fruit. Planta , 219(1): 84–94
doi: 10.1007/s00425-003-1191-4 pmid:14740213
15 Rupasinghe H P V, Almquist K C, Paliyath G, Murr D P (2001). Cloning of hmg1 and hmg2 cDNAs encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) and their expression and activity in relation to alpha-farnesene synthesis in apple. Plant Physiol Biochem , 39(11): 933–947
doi: 10.1016/S0981-9428(01)01316-X
16 Rupasinghe H P V, Paliyath G, Murr D P (1998). Biosynthesis of α-farnesene and its relation to superficial scald development in ‘Delicious’ apples. J Am Soc Hortic Sci , 123(5): 882–886
17 Yuan K J (2005). An improved method of cleaved amplified polymorphic sequence (CAPS) markers in Arabidopsis thaliana. J Agric Biotechnol , 13(5): 580–586 (in Chinese)
18 Yuan K J, Liu Q Z, Ai C X, Wei H R (2009). A method for amplifying the flanking unknown sequence of apple gene by PCR. J Agric Biotechnol , 17(6): 1083–1088 (in Chinese)
19 Yuan K J, Liu Q Z, Li B, Zhang L S (2007). Genomic organization and sequence polymorphism of E,E-alpha farnesene synthase gene in apples (Malus domestica Borkh.). Acta Horticulturae Sinica, 34(4),1003—1006 (in Chinese)
doi: 10.1007/s11703-008-0041-3
[1] Lesley BEUNING, Sol GREEN, Yar-Khing YAUK, . The genomic sequence of AFS-1―an alpha -farnesene synthase from the apple cultivar ‘Royal Gala’[J]. Front. Agric. China, 2010, 4(1): 74-78.
[2] Xuemei HUO, Hongwei HAN, Jun ZHANG, Minsheng YANG. Genetic diversity of Robinia pseudoacacia populations in China detected by AFLP markers[J]. Front Agric Chin, 2009, 3(3): 337-345.
[3] CAO Shangyin, GUO Junying, CHEN Yuling, XUE Huabai, ZHANG Qiuming, ZHU Zhiyong. Preliminary proteomics analysis of the total proteins of flower bud induction of apple trees[J]. Front. Agric. China, 2008, 2(4): 467-473.
[4] YAO Yuxin, ZHAI Heng, ZHAO Lingling, YI Kai, LIU Zhi, SONG Ye. Analysis of the apple fruit acid/low-acid trait by SSR markers[J]. Front. Agric. China, 2008, 2(4): 463-466.
[5] WANG Jianshe, YAO Jianchun, LI Wei. Construction of a molecular map for melon ( L.) based on SRAP[J]. Front. Agric. China, 2008, 2(4): 451-455.
[6] YAO Yuxin, HAO Yujin, LI Ming, PANG Mingli, LIU Zhi, ZHAI Heng. Gene clone, expression and enzyme activity assay of a cytosolic malate dehydrogenase from apple fruits[J]. Front. Agric. China, 2008, 2(3): 307-313.
[7] YUAN Kejun, LIU Qingzhong, LI Bo, ZHANG Lisi. Genomic structure and sequence polymorphism of E,E-alpha-farnesene synthase gene in apples ( Borkh.)[J]. Front. Agric. China, 2008, 2(2): 190-193.
[8] PAN Zhifen, ZOU Yixing, ZHAO Tao, ZHAI Xuguang, WU Fang, DENG Guangbing, YU Maoqun. Starch granule protein (SGP) polymorphism in cultivated naked barley from Qinghai-Tibet Plateau in China and relationship between SGPs and starch/amylose content[J]. Front. Agric. China, 2008, 2(1): 10-15.
[9] HAN Mingyu, LI Bingzhi, ZHANG Linsen, BAI Ru, Gao Dengtao. Characteristics of canopy and light transmittance in three types of apple orchards in Weibei areas of Shaanxi Province, China[J]. Front. Agric. China, 2008, 2(1): 93-96.
[10] ZHANG Jianguang, CHEN Shaochun, DI Bao, ZHANG Jianqiang, LIU Yufang, LI Yingli. Effect of high temperature and excessive light on glutathione content in apple peel[J]. Front. Agric. China, 2008, 2(1): 97-102.
[11] ZHENG Weiwei, CHEN Feng, ZHAI Heng, XU Yuehua, ZHANG Jing. Interactive effects of organic fertilizer, CaSO4 and amino acid Ca on Fuji apple in Burozem soil in China[J]. Front. Agric. China, 2007, 1(4): 460-467.
[12] WANG Xingfen, MA Jun, YANG Shuo, ZHANG Guiyin, MA Zhiying. Assessment of genetic diversity among Chinese upland cottons with Fusarium and/or Verticillium wilts resistance by AFLP and SSR markers[J]. Front. Agric. China, 2007, 1(2): 129-135.
[13] Jianguang ZHANG,Bao DI,Yingli LI,Jianqiang ZHANG,Jianshe SUN,Yufang LIU. Effect of microenvironments and exogenous substance application on 5’-nucleotidase activities in apple peel[J]. Front. Agric. China, 2007, 1(1): 67-71.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed