Please wait a minute...
Frontiers of Environmental Science & Engineering

ISSN 2095-2201

ISSN 2095-221X(Online)

CN 10-1013/X

Postal Subscription Code 80-973

2018 Impact Factor: 3.883

Front Envir Sci Eng Chin    2011, Vol. 5 Issue (2) : 277-282    https://doi.org/10.1007/s11783-010-0226-x
RESEARCH ARTICLE
Short-term effect of temperature variation on the competition between PAOs and GAOs during acclimation period of an EBPR system
Nanqi REN(), Han KANG, Xiuheng WANG, Nan LI
State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150090, China
 Download: PDF(329 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Sequencing batch reactor (SBR) for enhanced biological phosphorus removal (EBPR) processes was used to investigate the impact of the temperature shock on the competition between phosphorus-accumulating organisms (PAOs) and glycogen accumulating organisms (GAOs) in start-up stage. During the 34 days operation, SBR was set with temperature variation(0–5 d, 22±1°C; 6–13 d, 29±1°C; 14–34 d, 14±1°C). PAOs and GAOs were analyzed by fluorescent in situ hybridization (FISH), and intracellular polyphosphate granules were stained by Neisser-stain. The results showed that the influence of temperature shock on PAOs’ abundance was more serious than that on GAOs in the enriching process. Under sudden and substantially temperature variation, from 22±1°C to 29±1°C and then to 14±1°C, the domination of PAOs was deteriorated. After temperature shock, PAOs’ competitive advantages at low temperature that concluded in other study did not appear in our study. As mesophilic, GAOs (indicated by Alphaproteobacteria and Gammaproteobacteria) were more temperature adaptive and better grew and took the domination at 14±1°C in the end. In the competition process, organisms of tetrad forming organisms (TFOs)-like shape which were considered as typical GAOs, were observed. With the evidence of poly-P granules containing by Neisser-straining and result of FISH, these organisms of TFOs-like shape were better to be assumed as adaption state or a special self-protecting shape of PAOs.

Keywords fluorescent in situ hybridization (FISH)      tetrad forming organisms (TFOs)      temperature variation      enhanced biological phosphorus removal (EBPR)     
Corresponding Author(s): REN Nanqi,Email:rnq@hit.edu.cn   
Issue Date: 05 June 2011
 Cite this article:   
Nanqi REN,Han KANG,Xiuheng WANG, et al. Short-term effect of temperature variation on the competition between PAOs and GAOs during acclimation period of an EBPR system[J]. Front Envir Sci Eng Chin, 2011, 5(2): 277-282.
 URL:  
https://academic.hep.com.cn/fese/EN/10.1007/s11783-010-0226-x
https://academic.hep.com.cn/fese/EN/Y2011/V5/I2/277
probesequence (5′- 3′)specificityreference
EUB338mix
EUB338GCTGCCTCCCGTAGGAGTmost bacteria[11]
EUB338-IIGCAGCCACCCGTAGGTGTplanctomycetes[12]
EUB338-IIIGCTGCCACCCGTAGGTGTverrucomicrobiales[12]
PAOmix
PAO462CCGTCATCTACWCAGGGTATTAACPAO cluster Betaproteobacteria Rhodocyclus sp.[13]
PAO651CCCTCTGCCAAACTCCAG[13]
PAO846GTTAGCTACGGCACTAAAAGG[13]
DFmix
TFO_DF218GAAGCCTTTGCCCCTCAGcluster 1 Defluviicoccus spp. in Alphaproteobacteria[14]
TFO_DF618GCCTCACTTGTCTAACCG[14]
DF966GATACGACGCCCATGTCAAGGGcluster 2 Defluviicoccus spp. in Alphaproteobacteria[14]
DF1020CCGGCCGAACCGACTCCC[14]
GAOmix
GAO Q431TCCCCGCCTAAAGGGGTTGammaproteobacteria Competibacterphosphatis[13]
GAOQ989TTCCCCGGATGTCAAGGC[13]
Tab.1  Oligonucleotide probes used in this study
Fig.1  COD (a) and P (b) removal efficiency of SBR.
Fig.2  Bacterial population distributions observed by applying Fluorescence Hybridization. (a) 5 d. (b) 13 d. (c) 34 d. The green in (a) to (c) is sludge combined with EUBmix labeled FITC, the red is with PAOmix labeled CY3 and the yellow is with both EUBmix and PAOmix. (d) 34 d. The green in (d) is sludge hybridized with EUBmix labeled FITC, the red is with GAOmix labeled CY3, and the blue is with DFmix labeled CY5. Bar in all images= 5 μm
Fig.3  Contrast of FISH (a) and Neisser staining (b) from aerobic end on 19 d. The bar is 5 μm. The PAOs in (a) is yellow. The intracellular poly-P granule is black in (b)
Fig.4  Content of PAOs and GAOs (sum of and )
1 Panswad T, Doungchai A, Anotai J. Temperature effect on microbial community of enhanced biological phosphorus removal system. Water Research , 2003, 37(2): 409–415
doi: 10.1016/S0043-1354(02)00286-5 pmid:12502069
2 Lopez-Vazquez C M, Oehmen A, Hooijmans C M, Brdjanovic D, Gijzen H J. Yuan Z, van Loosdrecht M C M. Modeling the PAO-GAO competition: effects of carbon source, pH and temperature. Water Research , 2009, 43(2): 450–462
doi: 10.1016/j.watres.2008.10.032 pmid:19022471
3 Whang L M, Park J K. Competition between polyphosphate- and glycogen-accumulating organisms in enhanced-biological-phosphorus-removal systems: effect of temperature and sludge age.Water Environment Research , 2006, 78(1): 4–11
doi: 10.2175/106143005X84459 pmid:16553160
4 Lopez-Vazquez C M, Song Y I, Hooijmans C M, Brdjanovic D, Moussa M S, Gijzen H J, van Loosdrecht M C M. Short-term temperature effects on the anaerobic metabolism of glycogen accumulating organisms. Biotechnology and Bioengineering , 2007, 97(3): 483–495
doi: 10.1002/bit.21302 pmid:17171717
5 Lopez-Vazquez C M, Song Y I, Hooijmans C M, Brdjanovic D, Moussa M S, Gijzen H J, van Loosdrecht M C M. Temperature effects on the aerobic metabolism of glycogen-accumulating organisms. Biotechnology and Bioengineering , 2008, 101(2): 295–306
doi: 10.1002/bit.21892 pmid:18623226
6 Erdal U G, Erdal Z K, Randall C W. The competition between PAOs (phosphorus accumulating organisms) and GAOs (glycogen accumulating organisms) in EBPR (enhanced biological phosphorus removal) systems at different temperatures and the effects on system performance. Water Science and Technology , 2003, 47(11): 1–8
pmid:12906264
7 Lopez-Vazquez C M, Hooijmans C M, Brdjanovic D, Gijzen H J, van Loosdrecht M C M. Temperature effects on glycogen accumulating organisms. Water Research , 2009, 43(11): 2852–2864
doi: 10.1016/j.watres.2009.03.038 pmid:19380157
8 Li N, Wang X, Ren N, Zhang K, Kang H, You S. Effects of solid retention time (SRT) on sludge characteristics in enhanced biological phosphorus removal (EBPR) reactor. Chemical and Biochemical Engineering Quarterly , 2008, 22: 453–458
9 APHA. Standard Methods for the Examination of Water and Wastewater. 19th ed. Washington D C: American Public Health Accociation,1995
10 Amann R I. In situ identification of micro-organisms by whole cell hybridization with rRNA-targeted nucleic acid probes. In: Akkermans A D L, Elsas J D, de Bruij F J, eds. Molecular Microbial Ecology Manual vol. 3. 3. 6 . London: Kluwer, 1995: 1–15
11 Amann R I, Binder B J, Olson R J, Chisholm S W, Devereux R, Stahl D A. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Applied and Environmental Microbiology , 1990, 56(6): 1919–1925
pmid:2200342
12 Daims H, Brühl A, Amann R, Schleifer K H, Wagner M. The domain-specific probe EUB338 is insufficient for the detection of all Bacteria: development and evaluation of a more comprehensive probe set. Systematic and Applied Microbiology , 1999, 22(3): 434–444
pmid:10553296
13 Crocetti G R, Hugenholtz P, Bond P L, Schuler A, Keller J, Jenkins D, Blackall L L. Identification of polyphosphate-accumulating organisms and design of 16S rRNA-directed probes for their detection and quantitation. Applied and Environmental Microbiology , 2000, 66(3): 1175–1182
doi: 10.1128/AEM.66.3.1175-1182.2000 pmid:10698788
14 Wong M T, Tan F M, Ng W J, Liu W T. Identification and occurrence of tetrad-forming Alphaproteobacteria in anaerobic-aerobic activated sludge processes. Microbiology (Reading, England) , 2004, 150(11): 3741–3748
doi: 10.1099/mic.0.27291-0 pmid:15528660
15 Eikelboom D H, van Buijsen H J J. Microscopic sludge investigation manual, Delft: TNO Research Institute for Environmental Hygiene , 1981
16 Oehmen A, Lemos P C, Carvalho G, Yuan Z G, Keller J, Blackall L L, Reis M A. Advances in enhanced biological phosphorus removal: from micro to macro scale. Water Research , 2007, 41(11): 2271–2300
doi: 10.1016/j.watres.2007.02.030 pmid:17434562
17 Levantesi C, Serafim L S, Crocetti G R, Lemos P C, Rossetti S, Blackall L L, Reis M A M, Tandoi V. Analysis of the microbial community structure and function of a laboratory scale enhanced biological phosphorus removal reactor. Environmental Microbiology , 2002, 4(10): 559–569
doi: 10.1046/j.1462-2920.2002.00339.x pmid:12366750
18 Oehmen A, Zeng R J, Saunders A M, Blackall L L, Keller J, Yuan Z G. Anaerobic and aerobic metabolism of glycogen-accumulating organisms selected with propionate as the sole carbon source. Microbiology (Reading, England) , 2006, 152(9): 2767–2778
doi: 10.1099/mic.0.28065-0 pmid:16946271
19 Whang L M, Park J K. Competition between polyphosphate- and glycogen-accumulating organisms in biological phosphorus removal systems—effect of temperature. Water Science and Technology , 2002, 46(1-2): 191–194
pmid:12216623
20 Liu W T, Mino T, Nakamura K, Matsuo T. Glycogen-accumulating population and its anaerobic substrate uptake in anaerobic-aerobic activated sludge without biological phosphorus removal. Water Research , 1996, 30(1): 75–82
doi: 10.1016/0043-1354(95)00121-Z
21 Cech J S, Hartman P. Competition between polyphosphate and polysaccharide accumulating bacteria in enhanced biological phosphate removal system. Water Research , 1993, 27(7): 1219–1225
doi: 10.1016/0043-1354(93)90014-9
22 Bond P L, Hugenholtz P, Keller J, Blackall L L. Bacterial community structures of phosphate-removing and non-phosphate-removing activated sludges from sequencing batch reactors. Applied and Environmental Microbiology , 1995, 61(5): 1910–1916
pmid:7544094
23 Kang H, Wang X H, Li N, Ren N Q. Characterization of phosphate-accumulating organisms in starting-up EBPR by FISH analysis. Environmental Science , 2009, 30(1): 80–84
pmid:19353861
[1] Alberto MANNUCCI,Giulio MUNZ,Gualtiero MORI,Claudio LUBELLO,Jan A. OLESZKIEWICZ. Applicability of the Arrhenius model for Ammonia Oxidizing Bacteria subjected to temperature time gradients[J]. Front. Environ. Sci. Eng., 2015, 9(6): 988-994.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed