Please wait a minute...
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

Postal Subscription Code 80-967

2018 Impact Factor: 1.847

Front Med Chin    2009, Vol. 3 Issue (2) : 236-239     DOI: 10.1007/s11684-009-0040-7
RESEARCH ARTICLE |
Expression of protease-activated receptors on platelets in healthy individuals
Rui ZHU, Lin SHEN()
Department of Integrated Chinese and Western Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China
Download: PDF(92 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

This study aimed to investigate the expression of protease-activated receptors (PARs) on platelets in healthy individuals and preliminarily elucidate physiological functions of PARs. Thirty healthy volunteers, who did not take any anticoagulants and antiplatelet agents within 10 days before the examination, were recruited. Fasting venous blood (5 mL) was taken from the medial cubital vein in each individual and platelet-rich plasma (PRP) was prepared. The expression of PAR1 mRNA and PAR4 mRNA in PRP was determined by RT-PCR analysis. The results showed that the average levels of PAR1 mRNA and PAR4 mRNA on platelets in healthy individuals were 0.1601 ± 0.0269 and 0.1073 ± 0.0194 respectively. In combination with literature analysis, it was concluded that the thrombin signaling pathway plays a vital role in the development of hemostasis and thrombosis, and the selective PARs antagonist has the potential for extensive application in clinical practice.

Keywords protease-activated receptors      platelet     
Corresponding Authors: SHEN Lin,Email:shenlinhb@yahoo.com.cn   
Issue Date: 05 June 2009
URL:  
http://academic.hep.com.cn/fmd/EN/10.1007/s11684-009-0040-7     OR     http://academic.hep.com.cn/fmd/EN/Y2009/V3/I2/236
geneprimer sequence*(5'--3')PCR product size/bp
PAR1senseTGTGAACTGATCATGTTTATG708
antisense TTCGTAAGATAAGAGATATGT
PAR4senseGGCAACCTCTATGGTGCCTA244
antisense TTCGACCCAGTACAGCCTTC
β-actinsense GGTCAGAAGGATTCATATGTG615
antisense ATTGCCAATGGTGATGACCTG
Tab.1  Gene-specific primer sequences used in conventional PCR amplifications
Fig.1  The expression of PARs mRNA on platelets in healthy individuals. (a) β-active mRNA; (b) PAR1 mRNA; (c) PAR4 mRNA.
1 Ruggeri Z M. Platelets in atherothrombosis. Nat Med , 2002, 8(11): 1227-1234
doi: 10.1038/nm1102-1227
2 Kahn M L, Zheng Y W, Huang W, Bigornia V, Zeng D, Moff S, Farese R V Jr, Tam C, Coughlin S R. A dual thrombin receptor system for platelet activation. Nature , 1998, 394(6694): 690-694
doi: 10.1038/29325
3 Coughlin S R. How the protease thrombin talks to cells. Proc Natl Acad Sci USA , 1999, 96(20): 11023-11027
doi: 10.1073/pnas.96.20.11023
4 Macfarlane S R, Seatter M J, Kanke T, Hunter G D, Plevin R. Proteinase-activated receptors. Pharmacol Rev , 2001, 53(2): 245-282
5 Faruqi T R, Weiss E J, Shapiro M J, Huang W, Coughlin S R. Structure-function analysis of protease-activated receptor 4 tethered ligand peptides. Determinants of specificity and utility in assays of receptor function. J Biol Chem , 2000, 275(26): 19728-19734
doi: 10.1074/jbc.M909960199
6 Hamilton J R, Frauman A G, Cocks T M. Increased expression of protease-activated receptor-2 (PAR2) and PAR4 in human coronary artery by inflammatory stimuli unveils endothelium-dependent relaxations to PAR2 and PAR4 agonists. Circ Res , 2001, 89(1): 92-98
doi: 10.1161/hh1301.092661
7 Coughlin S R. Thrombin signalling and protease-activated receptors. Nature , 2000, 407(6801): 258-264
doi: 10.1038/35025229
8 Kahn M L, Nakanishi-Matsui M, Shapiro M J, Ishihara H, Coughlin S R. Protease-activated receptors 1 and 4 mediate activation of human platelets by thrombin. J Clin Invest , 1999, 103(6): 879-887
doi: 10.1172/JCI6042
9 Vu T K, Hung D T, Wheaton V I, Coughlin S R. Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell , 1991, 64(6): 1057-1068
doi: 10.1016/0092-8674(91)90261-V
10 Chen J, Ishii M, Wang L, Ishii K, Coughlin S R. Thrombin receptor activation: confirmation of the intramolecular tethered liganding hypothesis and discovery of an alternative liganding mode. J Biol Chem , 1994, 269(23): 16041-16045
11 Reed G L. Platelet secretory mechanisms. Semin Thromb Hemost , 2004, 30(4): 441-450
doi: 10.1055/s-2004-833479
12 Dorsam R T, Kunapuli S P. Central role of the P2Y12 receptor in platelet activation. J Clin Invest , 2004, 113(3): 340-345
13 Cook J J, Sitko G R, Bednar B, Condra C, Mellott M J, Feng D M, Nutt R F, Shafer J A, Gould R J, Connolly T M. An antibody against the exosite of the cloned thrombin receptor inhibits experimental arterial thrombosis in the African green monkey. Circulation , 1995, 91(12): 2961-2971
14 Sambrano G R, Weiss E J, Zheng Y W, Huang W, Coughlin S R. Role of thrombin signalling in platelets in haemostasis and thrombosis. Nature , 2001, 413(6851): 74-78
doi: 10.1038/35092573
15 Pakala R, Liang C T, Benedict C R. Inhibition of arterial thrombosis by a peptide ligand of the thrombin receptor. Thromb Res , 2000, 100(1): 89-96
doi: 10.1016/S0049-3848(00)00307-8
16 Hasan A A, Rebello S S, Smith E, Srikanth S, Werns S, Driscoll E, Faul J, Brenner D, Normolle D, Lucchesi B R, Schmaier A H. Thrombostatin inhibits induced canine coronary thrombosis. Thromb Haemost , 1999, 82(3): 1182-1187
17 Connolly T M, Condra C, Feng D M, Cook J J, Stranieri M T, Reilly C F, Nutt R F, Gould R J. Species variability in platelet and other cellular responsiveness to thrombin receptor-derived peptides. Thromb Haemost , 1994, 72(4): 627-633
18 Derian C K, Santulli R J, Tomko K A, Haertlein B J, Andrade-Gordon P. Species differences in platelet responses to thrombin and SFLLRN. Receptor-mediated calcium mobilization and aggregation and regulation by protein kinases. Thromb Res , 1995, 78(6): 505-519
doi: 10.1016/0049-3848(95)00084-5
19 Zhang H C, Derian C K, Andrade-Gordon P, Hoekstra W J, McComsey D F, White K B, Poulter B L, Addo M F, Cheung W M, Damiano B P, Oksenberg D, Reynolds E E, Pandey A, Scarborough R M, Maryanoff B E. Discovery and optimization of a novel series of thrombin receptor (par-1) antagonists: potent, selective peptide mimetics based on indole and indazole templates. J Med Chem , 2001, 44(7): 1021-1024
doi: 10.1021/jm000506s
20 Andrade-Gordon P, Derian C K, Maryanoff B E, Zhang H C, Addo M F, Cheung W M, Damiano B P, D'Andrea M R, Darrow A L, de Garavilla L, Eckardt A J, Giardino E C, Haertlein B J, McComsey D F. Administration of a potent antagonist of protease-activated receptor-1 (PAR-1) attenuates vascular restenosis following balloon angioplasty in rats. J Pharmacol Exp Ther , 2001, 298(1): 34-42
21 Derian C K, Damiano B P, Addo M F, Darrow A L, D'Andrea M R, Nedelman M, Zhang H C, Maryanoff B E, Andrade-Gordon P. Blockade of the thrombin receptor protease-activated receptor-1 with a small-molecule antagonist prevents thrombus formation and vascular occlusion in nonhuman primates. J Pharmacol Exp Ther , 2003, 304(2): 855-861
doi: 10.1124/jpet.102.042663
22 Ahn H S, Foster C, Boykow G, Stamford A, Manna M, Graziano M. Inhibition of cellular action of thrombin by N3-cyclopropyl-7-[[4-(1-methylethyl)phenyl]methyl]-7H-pyrrolo[3, 2-f]quinazoline-1,3-diamine (SCH 79797), a nonpeptide thrombin receptor antagonist. Biochem Pharmacol , 2000, 60(10): 1425-1434
doi: 10.1016/S0006-2952(00)00460-3
[1] Wenjing Zhang,Fei Gao,Donghe Lu,Na Sun,Xiaoxue Yin,Meili Jin,Yanhong Liu. Anti-β2 glycoprotein I antibodies in complex with β2 glycoprotein I induce platelet activation via two receptors: apolipoprotein E receptor 2' and glycoprotein I bα[J]. Front. Med., 2016, 10(1): 76-84.
[2] Guocheng LIU MD, Shouhua YANG MD, Zehua WANG MD, . The relationship between platelet-derived growth factor expression and angiogenesis/lymphangiogenesis in cervical cancer[J]. Front. Med., 2009, 3(4): 447-451.
[3] XIA Dasheng, SONG Yanqiu, LI Chao, ZHANG Feng, WEI Minxin. The change of serum leptin and its relationship with platelet membrane glycoprotein Ib in patients with coronary heart disease[J]. Front. Med., 2007, 1(4): 352-355.
[4] GONG Xiaowei, WEI Jie, LI Yusheng, CHENG Weiwei, DENG Peng, JIANG Yong. Involvement of p38 mitogen-activated protein kinase in the regulation of platelet-derived growth factor -induced cell migration[J]. Front. Med., 2007, 1(3): 248-252.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed