Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

Postal Subscription Code 80-967

2018 Impact Factor: 1.847

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Med.    2017, Vol. 11 Issue (3) : 378-385    https://doi.org/10.1007/s11684-017-0541-8
RESEARCH ARTICLE
Identification of differentially expressed miRNAs associated with chronic kidney disease–mineral bone disorder
Kyung Im Kim1, Sohyun Jeong2, Nayoung Han2, Jung Mi Oh2, Kook-Hwan Oh3, In-Wha Kim2()
1. College of Pharmacy, Korea University, Sejong 30019, Republic of Korea
2. College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 08826, Republic of Korea
3. Division of Nephrology, Department of Internal Medicine, Seoul National University Hospital, Seoul 03080, Republic of Korea
 Download: PDF(206 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

The purpose of this study is to characterize a meta-signature of differentially expressed mRNA in chronic kidney disease (CKD) to predict putative microRNA (miRNA) in CKD–mineral bone disorder (CKD–MBD) and confirm the changes in these genes and miRNA expression under uremic conditions by using a cell culture system. PubMed searches using MeSH terms and keywords related to CKD, uremia, and mRNA arrays were conducted. Through a computational analysis, a meta-signature that characterizes the significant intersection of differentially expressed mRNA and expected miRNAs associated with CKD–MBD was determined. Additionally, changes in gene and miRNA expressions under uremic conditions were confirmed with human Saos-2 osteoblast-like cells. A statistically significant mRNA meta-signature of upregulated and downregulated mRNA levels was identified. Furthermore, miRNA expression profiles were inferred, and computational analyses were performed with the imputed microRNA regulation based on weighted ranked expression and putative microRNA targets (IMRE) method to identify miRNAs associated with CKD occurrence. TLR4 and miR-146b levels were significantly associated with CKD–MBD. TLR4 levels were significantly downregulated, whereas pri-miR-146b and miR-146b were upregulated in the presence of uremic toxins in human Saos-2 osteoblast-like cells. Differentially expressed miRNAs associated with CKD-MBD were identified through a computational analysis, and changes in gene and miRNA expressions were confirmed with an in vitro cell culture system.
Keywords chronic kidney disease      microRNA      mineral bone disorder      uremia     
Corresponding Author(s): In-Wha Kim   
Just Accepted Date: 16 May 2017   Online First Date: 23 June 2017    Issue Date: 29 August 2017
 Cite this article:   
Kyung Im Kim,Sohyun Jeong,Nayoung Han, et al. Identification of differentially expressed miRNAs associated with chronic kidney disease–mineral bone disorder[J]. Front. Med., 2017, 11(3): 378-385.
 URL:  
https://academic.hep.com.cn/fmd/EN/10.1007/s11684-017-0541-8
https://academic.hep.com.cn/fmd/EN/Y2017/V11/I3/378
StudyNumber of samples (Uremia/normal)PlatformNumber of probesPublishedSample sources
GSE1507225 (8/17)Affymetrix Human Genome U133A Array
Affymetrix Human Genome U133 Plus 2.0 Array		22 283
54 675		2009Peripheral blood mononuclear cells
GSE3717195 (75/20)Affymetrix Human Genome U133 Plus 2.0 Array54 6752013Peripheral blood cells
GSE434846 (3/3)Affymetrix Human Genome U133A 2.0 Array22 2772013Monocytes
Tab.1  Datasets for computational analysis after preprocessing and quality control
GeneTm (°C)GenBank accession no.Forward primerReverse primer
ACTB56NM_001101.3AGAAAATCTGGCACCACACCAGAGGCGTACAGGGATAGCA
TLR460NM_138554.4TGGAAGTTGAACGAATGGAATGTGACCAGAACTGCTACAACAGATACT
Pri-miR-146b56AL121928.13AGACCCTCCCTGGAATAGGACACCTGGCTGGGAAGTTG
SPP156NM_001040058.1CAGCCATGAATTTCACAGCCGGGAGTTTCCATGAAGCCAC
Tab.2  Primer sequence and corresponding annealing temperatures applied for quantitative real-time PCR
Fig.1  Volcano plot depicting mRNA levels of heathy controls and uremic patients. The grey dots represent genes with FDR levels<0.05.
Fig.2  Changes in the expression levels of TLR4, pri-miR-146b, and mature miR-146b in the presence of uremia. Saos-2 cells were treated with uremia over a 24-h time period and harvested at the indicated time points. (A) TLR4 mRNA expression was determined via reverse transcription-polymerase chain reaction (RT-PCR) analysis and normalized to ACTB expression. (B) Pri-miR-146b mRNA expression was determined via RT-PCR analysis and normalized to ACTB expression. (C) miR-146b expression was determined via RT-PCR analysis and normalized to RNU6B expression. The bars show the mean and standard deviation of triplicate experiments. P values were determined using Mann–Whitney U tests.
Fig.3  Change in SPP1 mRNA expression levels after uremia treatment for 24 h. The bars show the mean and standard deviation of triplicate experiments. P values were determined using Mann–Whitney U tests.
Fig.4  ALP activity after treatment with uremia for 24 h. The bars show the mean and SD of triplicate experiments. The value of ALP activity was normalized by the value of untreated or zero-time-point control samples. P values were determined using Mann–Whitney U tests.
1 Meyer TW, Hostetter TH. Uremia. N Engl J Med 2007; 357(13): 1316–1325
https://doi.org/10.1056/NEJMra071313 pmid: 17898101
2 Duranton F, Cohen G, De Smet R, Rodriguez M, Jankowski J, Vanholder R, Argiles A; European Uremic Toxin Work Group. Normal and pathologic concentrations of uremic toxins. J Am Soc Nephrol 2012; 23(7): 1258–1270
https://doi.org/10.1681/ASN.2011121175 pmid: 22626821
3 Cibulka R, Racek J. Metabolic disorders in patients with chronic kidney failure. Physiol Res 2007; 56(6): 697–705
pmid: 17298212
4 Lanza D, Perna AF, Oliva A, Vanholder R, Pletinck A, Guastafierro S, Di Nunzio A, Vigorito C, Capasso G, Jankowski V, Jankowski J, Ingrosso D. Impact of the uremic milieu on the osteogenic potential of mesenchymal stem cells. PLoS One 2015; 10(1): e0116468
https://doi.org/10.1371/journal.pone.0116468 pmid: 25635832
5 Meijers BK, Claes K, Bammens B, de Loor H, Viaene L, Verbeke K, Kuypers D, Vanrenterghem Y, Evenepoel P. p-Cresol and cardiovascular risk in mild-to-moderate kidney disease. Clin J Am Soc Nephrol 2010; 5(7): 1182–1189
https://doi.org/10.2215/CJN.07971109 pmid: 20430946
6 Moe S, Drüeke T, Cunningham J, Goodman W, Martin K, Olgaard K, Ott S, Sprague S, Lameire N, Eknoyan G; Kidney Disease: Improving Global Outcomes (KDIGO). Definition, evaluation, and classification of renal osteodystrophy: a position statement from Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int 2006; 69(11): 1945–1953
https://doi.org/10.1038/sj.ki.5000414 pmid: 16641930
7 Menon V, Gul A, Sarnak MJ. Cardiovascular risk factors in chronic kidney disease. Kidney Int 2005; 68(4): 1413–1418
https://doi.org/10.1111/j.1523-1755.2005.00551.x pmid: 16164615
8 Hruska K, Mathew S, Lund R, Fang Y, Sugatani T. Cardiovascular risk factors in chronic kidney disease: does phosphate qualify? Kidney Int 2011; 79(S121): S9–S13 PMID: 26746860 
https://doi.org/10.1038/ki.2011.24
9 Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116(2): 281–297
https://doi.org/10.1016/S0092-8674(04)00045-5 pmid: 14744438
10 Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development 2005; 132(21): 4653–4662
https://doi.org/10.1242/dev.02073 pmid: 16224045
11 O’Connell RM, Rao DS, Chaudhuri AA, Baltimore D. Physiological and pathological roles for microRNAs in the immune system. Nat Rev Immunol 2010; 10(2): 111–122
https://doi.org/10.1038/nri2708 pmid: 20098459
12 Tili E, Michaille JJ, Croce CM. MicroRNAs play a central role in molecular dysfunctions linking inflammation with cancer. Immunol Rev 2013; 253(1): 167–184
https://doi.org/10.1111/imr.12050 pmid: 23550646
13 Nana-Sinkam SP, Croce CM. MicroRNAs as therapeutic targets in cancer. Transl Res 2011; 157(4): 216–225
https://doi.org/10.1016/j.trsl.2011.01.013 pmid: 21420032
14 Schöler N, Langer C, Döhner H, Buske C, Kuchenbauer F. Serum microRNAs as a novel class of biomarkers: a comprehensive review of the literature. Exp Hematol 2010; 38(12): 1126–1130
https://doi.org/10.1016/j.exphem.2010.10.004 pmid: 20977925
15 Isakova T, Gutiérrez OM, Patel NM, Andress DL, Wolf M, Levin A. Vitamin D deficiency, inflammation, and albuminuria in chronic kidney disease: complex interactions. J Ren Nutr 2011; 21(4): 295–302
https://doi.org/10.1053/j.jrn.2010.07.002 pmid: 20817560
16 Fang Y, Ginsberg C, Seifert M, Agapova O, Sugatani T, Register TC, Freedman BI, Monier-Faugere MC, Malluche H, Hruska KA. CKD-induced wingless/integration1 inhibitors and phosphorus cause the CKD-mineral and bone disorder. J Am Soc Nephrol 2014; 25(8): 1760–1773
https://doi.org/10.1681/ASN.2013080818 pmid: 24578135
17 Neal CS, Michael MZ, Pimlott LK, Yong TY, Li JY, Gleadle JM. Circulating microRNA expression is reduced in chronic kidney disease. Nephrol Dial Transplant 2011; 26(11): 3794–3802
https://doi.org/10.1093/ndt/gfr485 pmid: 21891774
18 Beltrami C, Clayton A, Phillips AO, Fraser DJ, Bowen T. Analysis of urinary microRNAs in chronic kidney disease. Biochem Soc Trans 2012; 40(4): 875–879
https://doi.org/10.1042/BST20120090 pmid: 22817751
19 Feichtinger J, McFarlane RJ, Larcombe LD. CancerMA: a web-based tool for automatic meta-analysis of public cancer microarray data. Database (Oxford) 2012; 2012: bas055
20 Ramasamy A, Mondry A, Holmes CC, Altman DG. Key issues in conducting a meta-analysis of gene expression microarray datasets. PLoS Med 2008; 5(9): e184
https://doi.org/10.1371/journal.pmed.0050184 pmid: 18767902
21 Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, Hornik K, Hothorn T, Huber W, Iacus S, Irizarry R, Leisch F, Li C, Maechler M, Rossini AJ, Sawitzki G, Smith C, Smyth G, Tierney L, Yang JY, Zhang J. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 2004; 5(10): R80
https://doi.org/10.1186/gb-2004-5-10-r80 pmid: 15461798
22 McCall MN, Bolstad BM, Irizarry RA. Frozen robust multiarray analysis (fRMA). Biostatistics 2010; 11(2): 242–253
https://doi.org/10.1093/biostatistics/kxp059 pmid: 20097884
23 Lee Y, Yang X, Huang Y, Fan H, Zhang Q, Wu Y, Li J, Hasina R, Cheng C, Lingen MW, Gerstein MB, Weichselbaum RR, Xing HR, Lussier YA. Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLOS Comput Biol 2010; 6(4): e1000730
https://doi.org/10.1371/journal.pcbi.1000730 pmid: 20369013
24 Scheid S, Spang R. twilight; a Bioconductor package for estimating the local false discovery rate. Bioinformatics 2005; 21(12): 2921–2922
https://doi.org/10.1093/bioinformatics/bti436 pmid: 15817688
25 Bauer O, Sharir A, Kimura A, Hantisteanu S, Takeda S, Groner Y. Loss of osteoblast Runx3 produces severe congenital osteopenia. Mol Cell Biol 2015; 35(7): 1097–1109
https://doi.org/10.1128/MCB.01106-14 pmid: 25605327
26 Kim HJ, Park J, Lee SK, Kim KR, Park KK, Chung WY. Loss of RUNX3 expression promotes cancer-associated bone destruction by regulating CCL5, CCL19 and CXCL11 in non-small cell lung cancer. J Pathol 2015; 237(4): 520–531
https://doi.org/10.1002/path.4597 pmid: 26239696
27 Reppe S, Refvem H, Gautvik VT, Olstad OK, Høvring PI, Reinholt FP, Holden M, Frigessi A, Jemtland R, Gautvik KM. Eight genes are highly associated with BMD variation in postmenopausal Caucasian women. Bone 2010; 46(3): 604–612
https://doi.org/10.1016/j.bone.2009.11.007 pmid: 19922823
28 Niu G, Li B, Sun J, Sun L. miR-454 is down-regulated in osteosarcomas and suppresses cell proliferation and invasion by directly targeting c-Met. Cell Prolif 2015; 48(3): 348–355
https://doi.org/10.1111/cpr.12187 pmid: 25880599
29 Huang RL, Yuan Y, Zou GM, Liu G, Tu J, Li Q. LPS-stimulated inflammatory environment inhibits BMP-2-induced osteoblastic differentiation through crosstalk between TLR4/MyD88/NF- kB and BMP/Smad signaling. Stem Cells Dev 2014; 23(3): 277–289 
https://doi.org/10.1089/scd.2013.0345 pmid: 24050190
30 Ando M, Shibuya A, Tsuchiya K, Akiba T, Nitta K. Reduced capacity of mononuclear cells to synthesize cytokines against an inflammatory stimulus in uremic patients. Nephron Clin Pract 2006; 104(3): c113–c119
https://doi.org/10.1159/000094446 pmid: 16837784
31 Wang ZS, Xu DM, Guan GJ, Cui MY, Wei Y, Tang LJ, Jia XY, Li WB. Clinical significance of toll-like receptor 4 expression on the surface of peripheral blood mononuclear cells in uremic patients. Natl Med J China (Zhonghua Yi Xue Za Zhi) 2010; 90(34): 2389–2391 (in Chinese)
pmid: 21092506
32 He X, Wang H, Jin T, Xu Y, Mei L, Yang J. TLR4 activation promotes bone marrow MSC proliferation and osteogenic differentiation via Wnt3a and Wnt5a signaling. PLoS One 2016; 11(3): e0149876
https://doi.org/10.1371/journal.pone.0149876 pmid: 26930594
33 Herzmann N, Salamon A, Fiedler T, Peters K. Lipopolysaccharide induces proliferation and osteogenic differentiation of adipose-derived mesenchymal stromal cells in vitro via TLR4 activation. Exp Cell Res 2017; 350(1): 115–122
https://doi.org/10.1016/j.yexcr.2016.11.012 pmid: 27865937
34 Taganov KD, Boldin MP, Chang KJ, Baltimore D. NF-κB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA 2006; 103(33): 12481–12486
https://doi.org/10.1073/pnas.0605298103 pmid: 16885212
35 Sato T, Liu X, Nelson A, Nakanishi M, Kanaji N, Wang X, Kim M, Li Y, Sun J, Michalski J, Patil A, Basma H, Holz O, Magnussen H, Rennard SI. Reduced miR-146a increases prostaglandin E2 in chronic obstructive pulmonary disease fibroblasts. Am J Respir Crit Care Med 2010; 182(8): 1020–1029
https://doi.org/10.1164/rccm.201001-0055OC pmid: 20522791
36 Cheng HS, Sivachandran N, Lau A, Boudreau E, Zhao JL, Baltimore D, Delgado-Olguin P, Cybulsky MI, Fish JE. MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. EMBO Mol Med 2013; 5(7): 1017–1034
https://doi.org/10.1002/emmm.201202318 pmid: 23733368
37 Larner-Svensson HM, Williams AE, Tsitsiou E, Perry MM, Jiang X, Chung KF, Lindsay MA. Pharmacological studies of the mechanism and function of interleukin-1β-induced miRNA-146a expression in primary human airway smooth muscle. Respir Res 2010; 11(1): 68
https://doi.org/10.1186/1465-9921-11-68 pmid: 20525168
38 Perry MM, Moschos SA, Williams AE, Shepherd NJ, Larner-Svensson HM, Lindsay MA. Rapid changes in microRNA-146a expression negatively regulate the IL-1β-induced inflammatory response in human lung alveolar epithelial cells. J Immunol 2008; 180(8): 5689–5698
https://doi.org/10.4049/jimmunol.180.8.5689 pmid: 18390754
39 Curtale G, Mirolo M, Renzi TA, Rossato M, Bazzoni F, Locati M. Negative regulation of Toll-like receptor 4 signaling by IL-10-dependent microRNA-146b. Proc Natl Acad Sci USA 2013; 110(28): 11499–11504
https://doi.org/10.1073/pnas.1219852110 pmid: 23798430
40 Asai Y, Hirokawa Y, Niwa K, Ogawa T. Osteoclast differentiation by human osteoblastic cell line SaOS-2 primed with bacterial lipid A. FEMS Immunol Med Microbiol 2003; 38(1): 71–79
https://doi.org/10.1016/S0928-8244(03)00111-1 pmid: 12900058
41 Fetahu IS, Tennakoon S, Lines KE, Gröschel C, Aggarwal A, Mesteri I, Baumgartner-Parzer S, Mader RM, Thakker RV, Kállay E. miR-135b- and miR-146b-dependent silencing of calcium-sensing receptor expression in colorectal tumors. Int J Cancer 2016; 138(1): 137–145
https://doi.org/10.1002/ijc.29681 pmid: 26178670
42 Bover J, Aguilar A, Baas J, Reyes J, Lloret MJ, Farré N, Olaya M, Canal C, Marco H, Andrés E, Trinidad P, Ballarin J. Calcimimetics in the chronic kidney disease-mineral and bone disorder. Int J Artif Organs 2009; 32(2): 108–121
pmid: 19363783
43 Oishi T, Uezumi A, Kanaji A, Yamamoto N, Yamaguchi A, Yamada H, Tsuchida K. Osteogenic differentiation capacity of human skeletal muscle-derived progenitor cells. PLoS One 2013; 8(2): e56641
https://doi.org/10.1371/journal.pone.0056641 pmid: 23457598
44 Kato S, Chmielewski M, Honda H, Pecoits-Filho R, Matsuo S, Yuzawa Y, Tranaeus A, Stenvinkel P, Lindholm B. Aspects of immune dysfunction in end-stage renal disease. Clin J Am Soc Nephrol 2008; 3(5): 1526–1533
https://doi.org/10.2215/CJN.00950208 pmid: 18701615
[1] FMD-17026-OF-KIW_suppl_1 Download
[1] Jian Liu, Pingyan Shen, Xiaobo Ma, Xialian Yu, Liyan Ni, Xu Hao, Weiming Wang, Nan Chen. White blood cell count and the incidence of hyperuricemia: insights from a community-based study[J]. Front. Med., 2019, 13(6): 741-746.
[2] Seo Yeon Baik, Hyunah Kim, So Jung Yang, Tong Min Kim, Seung-Hwan Lee, Jae Hyoung Cho, Hyunyong Lee, Hyeon Woo Yim, Kun-Ho Yoon, Hun-Sung Kim. Long-term effects of various types of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors on changes in glomerular filtration rate in Korea[J]. Front. Med., 2019, 13(6): 713-722.
[3] Hongli Yin,Tianyi Liu,Ying Zhang,Baofeng Yang. Caveolin proteins: a molecular insight into disease[J]. Front. Med., 2016, 10(4): 397-404.
[4] Felice Ho-Ching Tsang,Sandy Leung-Kuen Au,Lai Wei,Dorothy Ngo-Yin Fan,Joyce Man-Fong Lee,Carmen Chak-Lui Wong,Irene Oi-Lin Ng,Chun-Ming Wong. MicroRNA-142-3p and microRNA-142-5p are downregulated in hepatocellular carcinoma and exhibit synergistic effects on cell motility[J]. Front. Med., 2015, 9(3): 331-343.
[5] Feng Wang,Chen Chen,Daowen Wang. Circulating microRNAs in cardiovascular diseases: from biomarkers to therapeutic targets[J]. Front. Med., 2014, 8(4): 404-418.
[6] Rong Zhang, Di Wang, Zhuying Xia, Chao Chen, Peng Cheng, Hui Xie, Xianghang Luo. The role of microRNAs in adipocyte differentiation[J]. Front Med, 2013, 7(2): 223-230.
[7] Ji Qi, David Mu. MicroRNAs and lung cancers: from pathogenesis to clinical implications[J]. Front Med, 2012, 6(2): 134-155.
[8] Gang LI MD , Xiaojia XIONG MM , . MicroRNAs and hepatitis viruses[J]. Front. Med., 2009, 3(3): 265-270.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed