Please wait a minute...
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

Postal Subscription Code 80-967

2018 Impact Factor: 1.847

Front. Med.    2019, Vol. 13 Issue (2) : 267-276    https://doi.org/10.1007/s11684-017-0586-8
RESEARCH ARTICLE |
Preventive effect of Shenkang injection against high glucose-induced senescence of renal tubular cells
Biqiong Fu, Jie Yang, Jia Chen, Lirong Lin, Kehong Chen, Weiwei Zhang, Jianguo Zhang, Yani He()
Department of Nephrology, Daping Hospital, Army Medical University, Chongqing 400042, China
 Download: PDF(3377 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Shenkang injection (SKI) is a classic prescription composed of Radix Astragali, rhubarb, Astragalus, Safflower, and Salvia. This treatment was approved by the State Food and Drug Administration of China in 1999 for treatment of chronic kidney diseases based on good efficacy and safety. This study aimed to investigate the protective effect of SKI against high glucose (HG)-induced renal tubular cell senescence and its underlying mechanism. Primary renal proximal tubule epithelial cells were cultured in (1) control medium (control group), medium containing 5 mmol/L glucose; (2) mannitol medium (mannitol group), medium containing 5 mmol/L glucose, and 25 mmol/L mannitol; (3) HG medium (HG group) containing 30 mmol/L glucose; (4) SKI treatment at high (200 mg/L), medium (100 mg/L), or low (50 mg/L) concentration in HG medium (HG+ SKI group); or (5) 200 mg/L SKI treatment in control medium (control+ SKI group) for 72 h. HG-induced senescent cells showed the emergence of senescence associated heterochromatin foci, up-regulation of P16INK4 and cyclin D1, increased senescence-associated β-galactosidase activity, and elevated expression of membrane decoy receptor 2. SKI treatment potently prevented these changes in a dose-independent manner. SKI treatment prevented HG-induced up-regulation of pro-senescence molecule mammalian target of rapamycin and p66Shc and down-regulation of anti-senescence molecules klotho, sirt1, and peroxisome proliferator-activated receptor-g in renal tubular epithelial cells. SKI may be a novel strategy for protecting against HG-induced renal tubular cell senescence in treatment of diabetic nephropathy.

Keywords Shenkang injection      senescence      renal tubular epithelial cells      diabetic nephropathy     
Corresponding Authors: Yani He   
Just Accepted Date: 25 January 2018   Online First Date: 26 April 2018    Issue Date: 28 March 2019
 Cite this article:   
Biqiong Fu,Jie Yang,Jia Chen, et al. Preventive effect of Shenkang injection against high glucose-induced senescence of renal tubular cells[J]. Front. Med., 2019, 13(2): 267-276.
 URL:  
http://academic.hep.com.cn/fmd/EN/10.1007/s11684-017-0586-8
http://academic.hep.com.cn/fmd/EN/Y2019/V13/I2/267
Fig.1  HPLC of SKI used in the study. The main compounds of SKI include gallic acid, salvianic acid, protocatechualdehyde, propanoid acid, hydroxysafflor yellow A, emodin-O-glucoside, and salvianolic acid.
Name Batch number Dose pH value Residue on ignition (%) Total solids (mg/mL) Total anthraquinone (µg/mL) Total sugar (mg/mL) Polysacch-aride (mg/mL) Emodin chrysophanol (µg/mL)
Shenkang injection 201405041 20 mL 6.7 0.1 18.9 60 11.3 7.2 21
Shenkang injection 201405042 20 mL 6.7 0.2 17.8 60 10.9 6.7 21
Standard regulation 5.0–7.0 <0.5% >14.0 mg >50 µg >8.0 mg >4.0 mg >8 µg
Name Batch number Pyrogenic Sterile Heavy metals and toxic elements residue (µg)
Lead Cadmium Arsenic Mercury Copper
Shenkang injection 201405041 Compliance Compliance Not detected 0.22 1.83 Not detected Not detected
Shenkang injection 201405042 Compliance Compliance Not detected 0.14 0.11 Not detected Not detected
Standard regulation <12 µg <3 µg <6 µg <2 µg <150 µg
Tab.1  Batch number and quality control data of SKI
Genes Primer sequences Annealing temperature (°C)
Actin 5′ CATGGATGACGATATCGCTGC 3′ 60
5′ GTACGACCAGAGGCATACAGG 3′
Sirt1 5′ GCTGACGACTTCGACGACG 3′ 63
5′ TCGGTCAACAGGAGGTTGTCT3′
Klotho 5′ CAAAGTCTTCGGCCTTGTTC 3′ 56
5′ CTCCCCAAGCAAAGTCACA 3′
PPAR-g 5′ TGTCGGTTTCAGAAGTGCCTTG 3′ 60
5′ TTCAGCTGGTCGATATCACTGGAG 3′
mTOR 5′ GCCACCTGGTATGAGAAGC 3′ 63
5′ CCAACACTGCCCTGTAAAA 3′
P66shc 5′ CCGACTACCTGTGTTCCTTCTT 3′ 60
5′ CCCATCTTCAGCAGCCTTTCC 3′
Tab.2  Primer sequences used for RT-PCR analysis
Fig.2  Dose-dependent effect of SKI on expression of senescence markers in primary proximal tubular cells cultured under different conditions. (A) Cell morphology was examined under inverted microscopy after culturing for 72 h (magnification, 200×); (B) emergence of SAHF (magnification, 1200× ); (C, D) SA-β-Gal staining and percentage of SA-β-Gal-positive cells (magnification, 100×); (E, F) expression of P16INK4 in cell nuclei and quantitative analysis of P16INK4-positive cells (magnification, 400×); (G, H) expression of cyclin D1 in cell nuclei and quantitative analysis of cyclin D1-positive cells (magnification, 400×); and (I) emergence of DcR2 in cytoplasm (magnification, 1200×). Values are mean±SD of independent experiments with triplicate dishes. *P<0.05 vs. control; **P<0.01 vs. control; ***P<0.001 vs. control; #P<0.05 vs. HG group; ##P<0.01 vs. HG group; ###P<0.001 vs. HG group; P<0.05 vs. HG+ SKI (50 mg/L); ◊◊ P<0.01 vs. HG+ SKI (50 mg/L).
Fig.3  Dose-dependent effect of SKI on SOD and MDA in renal tubular epithelial cells.
Fig.4  Expression of mTOR and P66shc in renal tubular epithelial cells cultured under different conditions.
Fig.5  Expression of klotho, sirt1, and PPAR-g in renal tubular epithelial cells cultured under different conditions.
1 DMuñoz-Espín, MSerrano. Cellular senescence: from physiology to pathology. Nat Rev Mol Cell Biol 2014; 15(7): 482–496
https://doi.org/10.1038/nrm3823 pmid: 24954210
2 DVerzola, MT Gandolfo, GGaetani, AFerraris, RMangerini, FFerrario, BVillaggio, FGianiorio, FTosetti, UWeiss, PTraverso, MMji, G Deferrari, GGaribotto. Accelerated senescence in the kidneys of patients with type 2 diabetic nephropathy. Am J Physiol Renal Physiol 2008; 295(5): F1563–F1573
https://doi.org/10.1152/ajprenal.90302.2008 pmid: 18768588
3 PRuggenenti, G Remuzzi. Nephropathy of type-2 diabetes mellitus. J Am Soc Nephrol 1998; 9(11): 2157–2169
pmid: 9808106
4 FRodier, J Campisi. Four faces of cellular senescence. J Cell Biol 2011; 192(4): 547–556
https://doi.org/10.1083/jcb.201009094 pmid: 21321098
5 JMvan Deursen. The role of senescent cells in ageing. Nature 2014; 509(7501): 439–446
https://doi.org/10.1038/nature13193 pmid: 24848057
6 VVallon. The proximal tubule in the pathophysiology of the diabetic kidney. Am J Physiol Regul Integr Comp Physiol 2011; 300(5): R1009–R1022
https://doi.org/10.1152/ajpregu.00809.2010 pmid: 21228342
7 SMenini, L Amadio, GOddi, CRicci, CPesce, FPugliese, MGiorgio, EMigliaccio, PPelicci, CIacobini, GPugliese. Deletion of p66Shc longevity gene protects against experimental diabetic glomerulopathy by preventing diabetes-induced oxidative stress. Diabetes 2006; 55(6): 1642–1650
https://doi.org/10.2337/db05-1477 pmid: 16731826
8 ZQNing. Qiao Y, Bai J, Wang JW, Huang XF, Zhao X, Xu HC, Wen AD. Treatment of early diabetic nephropathy with Shenkang injection: a meta-analysis. J Shanxi College Trad Chin Med (Shanxi Zhong Yi Xue Yuan Xue Bao) 2014; 37: 39–43 (in Chinese)
9 ZWJiang, YY Lu, JLXia. The phase IV clinical observation study of Shenkang injection on chronic renal failure. J China Med Univ (Zhongguo Yi Ke Da Xue Xue Bao ) 2011; 40(10): 941–945 (in Chinese)
10 ZYong, R Yang, JChen. Shenkang injection in the treatment of diabetic nephropathy meta-analysis. J Liaoning Univ Trad Chin Med (Liaoning Zhong Yi Yao Da Xue Xue Bao) 2015; 17: 165–167 (in Chinese)
11 XWu, Y Guan, JYan, MLiu, Y Yin, JDuan, GWei, T Hu, YWeng, MXi, A Wen. Shenkang injection suppresses kidney fibrosis and oxidative stress via transforming growth factor-β/Smad3 signalling pathway in vivo and in vitro. J Pharm Pharmacol 2015; 67(8): 1054–1065
https://doi.org/10.1111/jphp.12412 pmid: 25864844
12 Chen HDu J,, XWang. Song L, He YH, Ye CH. Effect of Shengkang injection on hypertrophy and expression of p21 and p27 in glomerular mesangial cells of rats cultured in high glucose. Chin J Integr Trad West Med (Zhongguo Zhong Xi Yi Jie He Za Zhi ) 2006; 26: 68–71 (in Chinese)
13 SYao, J Zhang, DWang, JHou, W Yang, JDa, LCai, M Yang, BJiang, XLiu, D Guo, WWu. Discriminatory components retracing strategy for monitoring the preparation procedure of Chinese patent medicines by fingerprint and chemometric analysis. PLoS One 2015; 10(3):e0121366
14 STerryn, F Jouret, FVandenabeele, ISmolders, MMoreels, ODevuyst, PSteels, EVan Kerkhove. A primary culture of mouse proximal tubular cells, established on collagen-coated membranes. Am J Physiol Renal Physiol 2007; 293(2): F476–F485
https://doi.org/10.1152/ajprenal.00363.2006 pmid: 17475898
15 ACBreggia, J Himmelfarb. Primary mouse renal tubular epithelial cells have variable injury tolerance to ischemic and chemical mediators of oxidative stress. Oxid Med Cell Longev 2008; 1(1): 33–38
16 SKroening, E Neubauer, BWullich, JAten, M Goppelt-Struebe. Characterization of connective tissue growth factor expression in primary cultures of human tubular epithelial cells: modulation by hypoxia. Am J Physiol Renal Physiol 2010; 298(3): F796–F806
https://doi.org/10.1152/ajprenal.00528.2009 pmid: 20032117
17 JSatriano, H Mansoury, ADeng, KSharma, VVallon, RCBlantz, SCThomson. Transition of kidney tubule cells to a senescent phenotype in early experimental diabetes. Am J Physiol Cell Physiol 2010; 299(2): C374–C380
https://doi.org/10.1152/ajpcell.00096.2010 pmid: 20505038
18 JFNavarro-González, CMora-Fernández, MMuros de Fuentes, JGarcía-Pérez. Inflammatory molecules and pathways in the pathogenesis of diabetic nephropathy. Nat Rev Nephrol 2011; 7(6): 327–340
https://doi.org/10.1038/nrneph.2011.51 pmid: 21537349
19 HBraun, BMW Schmidt, MRaiss, ABaisantry, DMircea-Constantin, SWang, ML Gross, MSerrano, RSchmitt, AMelk. Cellular senescence limits regenerative capacity and allograft survival. J Am Soc Nephrol 2012; 23(9): 1467–1473
https://doi.org/10.1681/ASN.2011100967 pmid: 22797186
20 VVallon, SC Thomson. Renal function in diabetic disease models: the tubular system in the pathophysiology of the diabetic kidney. Annu Rev Physiol 2012; 74(1): 351–375
https://doi.org/10.1146/annurev-physiol-020911-153333 pmid: 22335797
21 PStenvinkel, TE Larsson. Chronic kidney disease: a clinical model of premature aging. Am J Kidney Dis 2013; 62(2): 339–351
https://doi.org/10.1053/j.ajkd.2012.11.051 pmid: 23357108
22 TTchkonia, Y Zhu, Jvan Deursen, JCampisi, JLKirkland. Cellular senescence and the senescent secretory phenotype: therapeutic opportunities. J Clin Invest 2013; 123(3): 966–972
https://doi.org/10.1172/JCI64098 pmid: 23454759
23 YUZhang, N Zhou, HWang, SWang, J He. Effect of Shenkang granules on the progression of chronic renal failure in 5/6 nephrectomized rats. Exp Ther Med 2015; 9(6): 2034–2042
https://doi.org/10.3892/etm.2015.2383 pmid: 26136932
24 BMolgora, R Bateman, GSweeney, DFinger, TDimler, RBEffros, HFValenzuela. Functional assessment of pharmacological telomerase activators in human T cells. Cells 2013; 2(1): 57–66
https://doi.org/10.3390/cells2010057 pmid: 24709644
25 GHu, J Liu, YZZhen, RXu, Y Qiao, JWei, PTu, YJ Lin. Rhein lysinate increases the median survival time of SAMP10 mice: protective role in the kidney. Acta Pharmacol Sin 2013; 34(4): 515–521
https://doi.org/10.1038/aps.2012.177 pmid: 23474705
26 GGCamici, M Schiavoni, PFrancia, MBachschmid, IMartin-Padura, MHersberger, FCTanner, PPelicci, MVolpe, PAnversa, TFLüscher, FCosentino. Genetic deletion of p66(Shc) adaptor protein prevents hyperglycemia-induced endothelial dysfunction and oxidative stress. Proc Natl Acad Sci USA 2007; 104(12): 5217–5222
https://doi.org/10.1073/pnas.0609656104 pmid: 17360381
27 MTrinei, I Berniakovich, EBeltrami, EMigliaccio, AFassina, PPelicci, MGiorgio. P66Shc signals to age. Aging (Albany NY) 2009; 1(6): 503–510
https://doi.org/10.18632/aging.100057 pmid: 20157533
28 MKitada, S Kume, ATakeda-Watanabe, KKanasaki, DKoya. Sirtuins and renal diseases: relationship with aging and diabetic nephropathy. Clin Sci (Lond) 2013; 124(3): 153–164
https://doi.org/10.1042/CS20120190 pmid: 23075334
29 OAsai, K Nakatani, TTanaka, HSakan, AImura, SYoshimoto, KSamejima, YYamaguchi, MMatsui, YAkai, N Konishi, MIwano, YNabeshima, YSaito. Decreased renal α-Klotho expression in early diabetic nephropathy in humans and mice and its possible role in urinary calcium excretion. Kidney Int 2012; 81(6): 539–547
https://doi.org/10.1038/ki.2011.423 pmid: 22217880
30 HCYang, S Deleuze, YZuo, SAPotthoff, LJMa, AB Fogo. The PPARγ agonist pioglitazone ameliorates aging-related progressive renal injury. J Am Soc Nephrol 2009; 20(11): 2380–2388
https://doi.org/10.1681/ASN.2008111138 pmid: 19797472
31 YLin, M Kuro-o, ZSun. Genetic deficiency of anti-aging gene klotho exacerbates early nephropathy in STZ-induced diabetes in male mice. Endocrinology 2013; 154(10): 3855–3863
https://doi.org/10.1210/en.2013-1053 pmid: 23928372
32 SXu, Y Cai, YWei. mTOR signaling from cellular senescence to organismal aging. Aging Dis 2013; 5(4): 263–273
pmid: 25110610
33 SKume, M Kitada, KKanasaki, HMaegawa, DKoya. Anti-aging molecule, Sirt1: a novel therapeutic target for diabetic nephropathy. Arch Pharm Res 2013; 36(2): 230–236
https://doi.org/10.1007/s12272-013-0019-4 pmid: 23361587
34 WHe, Y Wang, MZZhang, LYou, LS Davis, HFan, HCYang, ABFogo, RZent, RC Harris, MDBreyer, CMHao. Sirt1 activation protects the mouse renal medulla from oxidative injury. J Clin Invest 2010; 120(4): 1056–1068
https://doi.org/10.1172/JCI41563 pmid: 20335659
35 MKKim, SW Chung, DHKim, JMKim, EK Lee, JYKim, YMHa, YH Kim, JKNo, HSChung, KYPark, SHRhee, JSChoi, BPYu, T Yokozawa, YJKim, HYChung. Modulation of age-related NF-κB activation by dietary zingerone via MAPK pathway. Exp Gerontol 2010; 45(6): 419–426
https://doi.org/10.1016/j.exger.2010.03.005 pmid: 20211236
36 TYamagishi, Y Saito, TNakamura, STakeda, HKanai, HSumino, MKuro-o, YNabeshima, MKurabayashi, RNagai. Troglitazone improves endothelial function and augments renal klotho mRNA expression in Otsuka Long-Evans Tokushima Fatty (OLETF) rats with multiple atherogenic risk factors. Hypertens Res 2001; 24(6): 705–709
https://doi.org/10.1291/hypres.24.705 pmid: 11768731
37 HZhang, Y Li, YFan, JWu, B Zhao, YGuan, SChien, NWang. Klotho is a target gene of PPAR-γ. Kidney Int 2008; 74(6): 732–739
https://doi.org/10.1038/ki.2008.244 pmid: 18547997
38 MMSpeeckaert, C Vanfraechem, RSpeeckaert, JRDelanghe. Peroxisome proliferator-activated receptor agonists in a battle against the aging kidney. Ageing Res Rev 2014; 14: 1–18
https://doi.org/10.1016/j.arr.2014.01.006 pmid: 24503003
39 MVBlagosklonny. TOR-centric view on insulin resistance and diabetic complications: perspective for endocrinologists and gerontologists. Cell Death Dis 2013; 4(12): e964
https://doi.org/10.1038/cddis.2013.506 pmid: 24336084
[1] Liqin Wang, Rene Bernards. Taking advantage of drug resistance, a new approach in the war on cancer[J]. Front. Med., 2018, 12(4): 490-495.
[2] Qiuxia Han, Hanyu Zhu, Xiangmei Chen, Zhangsuo Liu. Non-genetic mechanisms of diabetic nephropathy[J]. Front. Med., 2017, 11(3): 319-332.
[3] Li Zhuo, Nianrong Zhang, Guming Zou, Dapeng Chen, Wenge Li. Clinical characteristics and outcomes of biopsy-proven diabetic nephropathy[J]. Front. Med., 2017, 11(3): 386-392.
[4] Kai Qu,Ting Lin,Zhixin Wang,Sinan Liu,Hulin Chang,Xinsen Xu,Fandi Meng,Lei Zhou,Jichao Wei,Minghui Tai,Yafeng Dong,Chang Liu. Reactive oxygen species generation is essential for cisplatin-induced accelerated senescence in hepatocellular carcinoma[J]. Front. Med., 2014, 8(2): 227-235.
[5] Tian Wang, Yan Li, Abidan Tuerhanjiang, Wenwen Wang, Zhangying Wu, Ming Yuan, Shixuan Wang. Correlation of Twist upregulation and senescence bypass during the progression and metastasis of cervical cancer[J]. Front Med, 2014, 8(1): 106-112.
[6] Qi RUI, Qin LU, Dayong WANG. Administration with Bushenkangshuai Tang alleviates UV irradiation- and oxidative stress-induced lifespan defects in nematode Caenorhabditis elegans[J]. Front Med Chin, 2009, 3(1): 76-90.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed