Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

Postal Subscription Code 80-967

2018 Impact Factor: 1.847

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Med.    2018, Vol. 12 Issue (2) : 196-205    https://doi.org/10.1007/s11684-017-0560-5
RESEARCH ARTICLE
Simultaneous detection and characterization of toxigenic Clostridium difficile directly from clinical stool specimens
Hanjiang Lai1, Chen Huang2, Jian Cai3, Julian Ye2, Jun She1, Yi Zheng4, Liqian Wang5, Yelin Wei1, Weijia Fang4, Xianjun Wang5, Yi-Wei Tang6,7, Yun Luo2(), Dazhi Jin2()
1. The First People’s Hospital of Xiaoshan District, Hangzhou 311021, China
2. Department of Microbiology
3. Department of Disease Control and Prevention, Zhejiang Provincial Center for Disease Control and Prevention, Hangzhou 310051, China
4. Biotherapy Center for Medical Oncology, the First Affiliated Hospital, Zhejiang University, Hangzhou 310003, China
5. Department of Laboratory Medicine, Hangzhou First People’s Hospital, Hangzhou 310006, China
6. Department of Laboratory Medicine, Memorial Sloan Kettering Cancer Center
7. Department of Pathology and Laboratory Medicine, Weill Medical College of Cornell University, New York, NY 10065, USA
 Download: PDF(211 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

We employed a multiplex polymerase chain reaction (PCR) coupled with capillary electrophoresis (mPCR-CE) targeting six Clostridium difficile genes, including tpi, tcdA, tcdB, cdtA, cdtB, and a deletion in tcdC for simultaneous detection and characterization of toxigenic C. difficile directly from fecal specimens. The mPCR-CE had a limit of detection of 10 colony-forming units per reaction with no cross-reactions with other related bacterial genes. Clinical validation was performed on 354 consecutively collected stool specimens from patients with suspected C. difficile infection and 45 isolates. The results were compared with a reference standard combined with BD MAX Cdiff, real-time cell analysis assay (RTCA), and mPCR-CE. The toxigenic C. difficile species were detected in 36 isolates and 45 stool specimens by the mPCR-CE, which provided a positive rate of 20.3% (81/399). The mPCR-CE had a specificity of 97.2% and a sensitivity of 96.0%, which was higher than RTCA (x2 = 5.67, P = 0.017) but lower than BD MAX Cdiff (P = 0.245). Among the 45 strains, 44 (97.8%) were determined as non-ribotype 027 by the mPCR-CE, which was fully agreed with PCR ribotyping. Even though ribotypes 017 (n = 8, 17.8%), 001 (n = 6, 13.3%), and 012 (n = 7, 15.6%) were predominant in this region, ribotype 027 was an important genotype monitored routinely. The mPCR-CE provided an alternative diagnosis tool for the simultaneous detection of toxigenic C. difficile in stool and potentially differentiated between RT027 and non-RT027.
Keywords Clostridium difficile      multiplex PCR      capillary electrophoresis      detection      characterization     
Corresponding Author(s): Yun Luo,Dazhi Jin   
Just Accepted Date: 25 September 2017   Online First Date: 31 October 2017    Issue Date: 02 April 2018
 Cite this article:   
Hanjiang Lai,Chen Huang,Jian Cai, et al. Simultaneous detection and characterization of toxigenic Clostridium difficile directly from clinical stool specimens[J]. Front. Med., 2018, 12(2): 196-205.
 URL:  
https://academic.hep.com.cn/fmd/EN/10.1007/s11684-017-0560-5
https://academic.hep.com.cn/fmd/EN/Y2018/V12/I2/196
Bacterial origin ATCC number tcdA tcdB cdtA cdtB 18 bp deletion in tcdC
C. difficile 43255 + + − − WTb
C. difficile 700057 − − − − WT
C. difficile BAA-1870 + + + + 18 bp deletion
C. difficile BAA-1804 + + − − WT
C. difficile BAA-1803 + + + + 18 bp deletion
C. difficile BAA-1801 − − − − WT
C. difficile 43598 + + − − WT
C. difficile BAA-1812 + + − − WT
Vibrio cholerae BAA-2163, 39541, 25870, 55866 N/Aa
Vibrio parahemolyticus 43996 N/A
Vibrio vulnificus 27562 N/A
Clostridium perfringens 27057 N/A
Clostridium botulinum 19397 N/A
Campylobacter jejuni 33560 N/A
Enterobacter aerogenes 13048 N/A
Escherichia coli O157:H7 43888 N/A
Listeria monocytogenes 19111 N/A
Shigella flexneri 55556 N/A
Salmonella enterica 51960 N/A
Tab.1  Bacterial strains
Gene target Primer name Sequence (5′−3′) Primer concentration (mmol/L) Product size (bp)
Tpi tpi-F AAAGAAGCTACTAAGGGTACAAA 0.80 229
tpi-R CATAATATTGGGTCTATTCCTAC 0.80
tcdA tcdA-F AGGGCTAATAATCTTACTATGTC 0.60 258
tcdA-R ATCTCAAATCAATAAACCTACAG 0.60
tcdB tcdB-F AATGCATTTTTGATAAACACATTG 0.50 329
tcdB-R AAGTTTCTAACATCATTTCCAC 0.50
tcdC tcdC-F TGCTGAACCATGGTTCAA 1.0 177/159
tcdC-R GCTAATTGGTCATAAGTAATAC 1.0
cdtA cdtA-F TTACCTAGAAATACTGGTATGTTA 1.1 303
cdtA-R AATTATTAATTGCAGTATATCCTC 1.1
cdtB cdtB-F CTACAAGATAAAAATTTAGGTTCA 0.85 361
cdtB-R CTGTATATGGATCTCCAGCA 0.85
Tab.2  Primer pairs
tpia tcdA tcdB cdtA cdtB 18 bp deletion in tcdC Interpretation
− N/Ab N/A N/A N/A N/A No C. difficile
+ − − N/A N/A N/A Nontoxigenic C. difficile
+ +/- –/ + − − WTc Toxigenic C. difficile
+ + + − − WT Toxigenic C. difficile
+ + + + + WT Toxigenic C. difficile
Md Toxigenic and ribotype 027 C. difficile
+ + + − + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + + + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − + + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ + − − + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ − + + + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ − + + − WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
+ − + – + WT Toxigenic C. difficile
M Toxigenic and ribotype 027 C. difficile
− At least one toxin gene positive WT Invalid results
M
Tab.3  Interpretation of mPCR-CE detection results in 354 stool specimens
Fig.1  Representative mPCR-CE results in clinical specimens. Blue peaks, red triangles, X axis, and Y axis represent positive PCR products, standard size markers, length of PCR amplicon, and fluorescence intensity, respectively. (A) A schematic diagram of distribution of six target C. difficile genes according to their sizes. 1: Presence of an 18 bp deletion in tcdC gene. 2: Absence of an 18 bp deletion in tcdC gene. 3: tpi gene. 4: tcdA gene. 5: cdtA gene. 6: tcdB gene. 7: cdtB gene. (B) tpi gene was positive, indicating that no C. difficile existed in this clinical stool specimen. (C) This clinical stool specimen was positive for toxigenic C. difficile with tcdA, tcdB, and tpi genes without an 18 bp deletion in tcdC gene.
Type Assay Number of stool specimens with indicated result Sensitivity (%) Specificity (%) PPV
(%)		 NPV
(%)
S+ T+ S+ T− S− T+ S− T−
Stool mPCR-CE 37 1 8 308 97.4 97.5 82.2 99.7
BD MAX Cdiff 38 0 10 306 100.0 96.8 79.2 100.0
RTCA 31 7 2 314 81.6 99.4 93.9 97.8
Strain mPCR-CE 35 2 1 7 94.6 87.5 N.A. N.A.
BD MAX Cdiff 37 0 1 7 100.0 87.5 N.A. N.A.
RTCA 31 6 0 8 83.8 100.0 N.A. N.A.
Total mPCR-CE 72 3 9 315 96.0 97.2 N.A. N.A.
BD MAX Cdiff 75 0 11 313 100.0 96.6 N.A. N.A.
RTCA 62 13 2 322 82.7 99.4 N.A. N.A.
Tab.4  Sensitivity, specificity, and predictive values for toxigenic C. difficile by mPCR-CEa, BD MAX, and RTCA assays
Fig.2  Distribution of PCR ribotypes.
Assay Hands-on time (min) Test turnaround time (min) Cost per test (RMB)b
mPCR-CE 25 132.5 35.5
BD MAX Cdiff 8 130 150
RTCA 55c 1381.1 82.5
Tab.5  Comparison by the three assays for toxigenic C. difficile detectiona
1 Leffler DA, Lamont JT. Clostridium difficile Infection. N Engl J Med 2015; 373(3): 287–288
pmid: 26176396
2 Kelly CP, LaMont JT. Clostridium difficile—more difficult than ever. N Engl J Med 2008; 359(18): 1932–1940
https://doi.org/10.1056/NEJMra0707500 pmid: 18971494
3 Indra A, Schmid D, Huhulescu S, Hell M, Gattringer R, Hasenberger P, Fiedler A, Wewalka G, Allerberger F. Characterization of clinical Clostridium difficile isolates by PCR ribotyping and detection of toxin genes in Austria, 2006−2007. J Med Microbiol 2008; 57(6): 702–708
https://doi.org/10.1099/jmm.0.47476-0 pmid: 18480326
4 McDonald LC, Killgore GE, Thompson A, Owens RC Jr, Kazakova SV, Sambol SP, Johnson S, Gerding DN. An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med 2005; 353(23): 2433–2441
https://doi.org/10.1056/NEJMoa051590 pmid: 16322603
5 Collins DA, Hawkey PM, Riley TV. Epidemiology of Clostridium difficile infection in Asia. Antimicrob Resist Infect Control 2013; 2(1): 21
https://doi.org/10.1186/2047-2994-2-21 pmid: 23816346
6 Asensio A, Monge D. Epidemiology of Clostridium difficile infection in Spain. Enferm Infecc Microbiol Clin 2012; 30(6): 333–337 ( in Spanish)
https://doi.org/10.1016/j.eimc.2011.09.010 pmid: 22136747
7 Bourgault AM, Lamothe F, Loo VG, Poirier L. In vitro susceptibility of Clostridium difficile clinical isolates from a multi-institutional outbreak in Southern Québec, Canada. Antimicrob Agents Chemother 2006; 50(10): 3473–3475
https://doi.org/10.1128/AAC.00479-06 pmid: 17005836
8 Borgmann S, Kist M, Jakobiak T, Reil M, Scholz E, von Eichel-Streiber C, Gruber H, Brazier JS, Schulte B. Increased number of Clostridium difficile infections and prevalence of Clostridium difficile PCR ribotype 001 in southern Germany. Euro Surveill 2008; 13(49): 19057
pmid: 19081002
9 Jin D, Luo Y, Huang C, Cai J, Ye J, Zheng Y, Wang L, Zhao P, Liu A, Fang W, Wang X, Xia S, Jiang J, Tang YW. Molecular epidemiology of Clostridium difficile infection in hospitalized patients in Eastern China. J Clin Microbiol2017;55(3):801–810
https://doi.org/10.1128/JCM.01898-16 pmid: 27974547
10 Snydman DR, McDermott LA, Jacobus NV, Thorpe C, Stone S, Jenkins SG, Goldstein EJ, Patel R, Forbes BA, Mirrett S, Johnson S, Gerding DN. U.S.-based national sentinel surveillance study for the epidemiology of Clostridium difficile-associated diarrheal isolates and their susceptibility to fidaxomicin. Antimicrob Agents Chemother 2015; 59(10): 6437–6443
https://doi.org/10.1128/AAC.00845-15 pmid: 26239985
11 Debast SB, Bauer MP, Kuijper EJ; European Society of Clinical Microbiology and Infectious Diseases.European Society of Clinical Microbiology and Infectious Diseases: update of the treatment guidance document for Clostridium difficile infection. Clin Microbiol Infect 2014; 20(Suppl 2): 1–26
https://doi.org/10.1111/1469-0691.12418 pmid: 24118601
12 Loo VG, Poirier L, Miller MA, Oughton M, Libman MD, Michaud S, Bourgault AM, Nguyen T, Frenette C, Kelly M, Vibien A, Brassard P, Fenn S, Dewar K, Hudson TJ, Horn R, René P, Monczak Y, Dascal A. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. N Engl J Med 2005; 353(23): 2442–2449
https://doi.org/10.1056/NEJMoa051639 pmid: 16322602
13 Merrigan M, Venugopal A, Mallozzi M, Roxas B, Viswanathan VK, Johnson S, Gerding DN, Vedantam G. Human hypervirulent Clostridium difficile strains exhibit increased sporulation as well as robust toxin production. J Bacteriol 2010; 192(19): 4904–4911
https://doi.org/10.1128/JB.00445-10 pmid: 20675495
14 Perelle S, Gibert M, Bourlioux P, Corthier G, Popoff MR. Production of a complete binary toxin (actin-specific ADP-ribosyltransferase) by Clostridium difficile CD196. Infect Immun 1997; 65(4): 1402–1407
pmid: 9119480
15 Samie A, Obi CL, Franasiak J, Archbald-Pannone L, Bessong PO, Alcantara-Warren C, Guerrant RL. PCR detection of Clostridium difficile triose phosphate isomerase (tpi), toxin A (tcdA), toxin B (tcdB), binary toxin (cdtA, cdtB), and tcdC genes in Vhembe District, South Africa. Am J Trop Med Hyg 2008; 78(4): 577–585
pmid: 18385352
16 Lemee L, Dhalluin A, Testelin S, Mattrat MA, Maillard K, Lemeland JF, Pons JL. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J Clin Microbiol 2004; 42(12): 5710–5714
https://doi.org/10.1128/JCM.42.12.5710-5714.2004 pmid: 15583303
17 Curry SR, Marsh JW, Muto CA, O’Leary MM, Pasculle AW, Harrison LH. tcdC genotypes associated with severe TcdC truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 2007; 45(1): 215–221
https://doi.org/10.1128/JCM.01599-06 pmid: 17035492
18 Brecher SM, Novak-Weekley SM, Nagy E. Laboratory diagnosis of Clostridium difficile infections: there is light at the end of the colon. Clin Infect Dis 2013; 57(8): 1175–1181
https://doi.org/10.1093/cid/cit424 pmid: 23788237
19 Ryder AB, Huang Y, Li H, Zheng M, Wang X, Stratton CW, Xu X, Tang YW. Assessment of Clostridium difficile infections by quantitative detection of tcdB toxin by use of a real-time cell analysis system. J Clin Microbiol 2010; 48(11): 4129–4134
https://doi.org/10.1128/JCM.01104-10 pmid: 20720023
20 Quinn CD, Sefers SE, Babiker W, He Y, Alcabasa R, Stratton CW, Carroll KC, Tang YW. Diff Quik Chek complete enzyme immunoassay provides a reliable first-line method for detection of Clostridium difficile in stool specimens. J Clin Microbiol 2010; 48(2): 603–605
https://doi.org/10.1128/JCM.01614-09 pmid: 19955275
21 Sloan LM, Duresko BJ, Gustafson DR, Rosenblatt JE. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis of Clostridium difficile infection. J Clin Microbiol 2008; 46(6): 1996–2001
https://doi.org/10.1128/JCM.00032-08 pmid: 18434563
22 Persson S, Torpdahl M, Olsen KE. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcdA) and toxin B (tcdB) and the binary toxin (cdtA/cdtB) genes applied to a Danish strain collection. Clin Microbiol Infect 2008; 14(11): 1057–1064
https://doi.org/10.1111/j.1469-0691.2008.02092.x pmid: 19040478
23 O’Horo JC, Jones A, Sternke M, Harper C, Safdar N. Molecular techniques for diagnosis of Clostridium difficile infection: systematic review and meta-analysis. Mayo Clin Proc 2012; 87(7): 643–651
https://doi.org/10.1016/j.mayocp.2012.02.024 pmid: 22766084
24 Chapin KC, Dickenson RA, Wu F, Andrea SB. Comparison of five assays for detection of Clostridium difficile toxin. J Mol Diagn 2011; 13(4): 395–400
https://doi.org/10.1016/j.jmoldx.2011.03.004 pmid: 21704273
25 Huang B, Li H, Jin D, Stratton CW, Tang YW. Real-time cellular analysis for quantitative detection of functional Clostridium difficile toxin in stool. Expert Rev Mol Diagn 2014; 14(3): 281–291
https://doi.org/10.1586/14737159.2014.900442 pmid: 24649817
26 Chow WH, McCloskey C, Tong Y, Hu L, You Q, Kelly CP, Kong H, Tang YW, Tang W. Application of isothermal helicase-dependent amplification with a disposable detection device in a simple sensitive stool test for toxigenic Clostridium difficile. J Mol Diagn 2008; 10(5): 452–458
https://doi.org/10.2353/jmoldx.2008.080008 pmid: 18669881
27 Polage CR, Gyorke CE, Kennedy MA, Leslie JL, Chin DL, Wang S, Nguyen HH, Huang B, Tang YW, Lee LW, Kim K, Taylor S, Romano PS, Panacek EA, Goodell PB, Solnick JV, Cohen SH. Overdiagnosis of Clostridium difficile infection in the molecular test era. JAMA Intern Med 2015; 175(11): 1792–1801
https://doi.org/10.1001/jamainternmed.2015.4114 pmid: 26348734
28 Shin BM, Yoo SM, Shin WC. Evaluation of Xpert C. difficile, BD MAX Cdiff, IMDx C. difficile for Abbott m2000, and Illumigene C. difficile assays for direct detection of toxigenic Clostridium difficile in stool specimens. Ann Lab Med 2016; 36(2): 131–137
https://doi.org/10.3343/alm.2016.36.2.131 pmid: 26709260
29 Du P, Cao B, Wang J, Li W, Jia H, Zhang W, Lu J, Li Z, Yu H, Chen C, Cheng Y. Sequence variation in tcdA and tcdB of Clostridium difficile: ST37 with truncated tcdA is a potential epidemic strain in China. J Clin Microbiol 2014; 52(9): 3264–3270
https://doi.org/10.1128/JCM.03487-13 pmid: 24958798
30 Cheng JW, Xiao M, Kudinha T, Xu ZP, Hou X, Sun LY, Zhang L, Fan X, Kong F, Xu YC. The first two Clostridium difficile ribotype 027/ST1 isolates identified in Beijing, China—an emerging problem or a neglected threat? Sci Rep 2016; 6(1): 18834
https://doi.org/10.1038/srep18834 pmid: 26740150
31 Wang P, Zhou Y, Wang Z, Xie S, Zhang T, Lin M, Li R, Tan J, Chen Y, Jiang B. Identification of Clostridium difficile ribotype 027 for the first time in Mainland China. Infect Control Hosp Epidemiol 2014; 35(1): 95–98
https://doi.org/10.1086/674405 pmid: 24334809
32 Oh MH, Paek SH, Shin GW, Kim HY, Jung GY, Oh S. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR. J Food Prot 2009; 72(6): 1262–1266
https://doi.org/10.4315/0362-028X-72.6.1262 pmid: 19610337
33 Hung CC, Chen CP, Lin SP, Chien SC, Lee CN, Cheng WF, Hsieh WS, Liu MS, Su YN, Lin WL. Quantitative assay of deletion or duplication genotype by capillary electrophoresis system: application in Prader−Willi syndrome and Duchenne muscular dystrophy. Clin Chem 2006; 52(12): 2203–2210
https://doi.org/10.1373/clinchem.2006.071118 pmid: 17040959
34 Guo L, Qiu B, Chi Y, Chen G. Using multiple PCR and CE with chemiluminescence detection for simultaneous qualitative and quantitative analysis of genetically modified organism. Electrophoresis 2008; 29(18): 3801–3809
https://doi.org/10.1002/elps.200800103 pmid: 18850650
35 Brooks G, Carroll K, Butel J, Morse S. Jawetz, Melnick & Adelberg’s Medical Microbiology. Columbus, OH: McGraw-Hill, 2007
36 Fang WJ, Jing DZ, Luo Y, Fu CY, Zhao P, Qian J, Tian BR, Chen XG, Zheng YL, Zheng Y, Deng J, Zou WH, Feng XR, Liu FL, Mou XZ, Zheng SS. Clostridium difficile carriage in hospitalized cancer patients: a prospective investigation in Eastern China. BMC Infect Dis 2014; 14(1): 523
https://doi.org/10.1186/1471-2334-14-523 pmid: 25267108
37 Bélanger SD, Boissinot M, Clairoux N, Picard FJ, Bergeron MG. Rapid detection of Clostridium difficile in feces by real-time PCR. J Clin Microbiol 2003; 41(2): 730–734
https://doi.org/10.1128/JCM.41.2.730-734.2003 pmid: 12574274
38 Sanchez-Vega B, Vega F, Medeiros LJ, Lee MS, Luthra R. Quantification of bcl-2/JH fusion sequences and a control gene by multiplex real-time PCR coupled with automated amplicon sizing by capillary electrophoresis. J Mol Diagn 2002, 4(4): 223–229
pmid: 12411590
39 Spigaglia P, Mastrantonio P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 2002; 40(9): 3470–3475
https://doi.org/10.1128/JCM.40.9.3470-3475.2002 pmid: 12202595
40 Huang B, Jin D, Zhang J, Sun JY, Wang X, Stiles J, Xu X, Kamboj M, Babady NE, Tang YW. Real-time cellular analysis coupled with a specimen enrichment accurately detects and quantifies Clostridium difficile toxins in stool. J Clin Microbiol 2014; 52(4): 1105–1111
https://doi.org/10.1128/JCM.02601-13 pmid: 24452160
41 Indra A, Blaschitz M, Kernbichler S, Reischl U, Wewalka G, Allerberger F. Mechanisms behind variation in the Clostridium difficile 16S-23S rRNA intergenic spacer region. J Med Microbiol 2010; 59(11): 1317–1323
https://doi.org/10.1099/jmm.0.020792-0 pmid: 20705731
42 Indra A, Huhulescu S, Schneeweis M, Hasenberger P, Kernbichler S, Fiedler A, Wewalka G, Allerberger F, Kuijper EJ. Characterization of Clostridium difficile isolates using capillary gel electrophoresis-based PCR ribotyping. J Med Microbiol 2008; 57(11): 1377–1382
https://doi.org/10.1099/jmm.0.47714-0 pmid: 18927415
43 Carroll KC, Buchan BW, Tan S, Stamper PD, Riebe KM, Pancholi P, Kelly C, Rao A, Fader R, Cavagnolo R, Watson W, Goering RV, Trevino EA, Weissfeld AS, Ledeboer NA. Multicenter evaluation of the Verigene Clostridium difficile nucleic acid assay. J Clin Microbiol 2013; 51(12): 4120–4125
https://doi.org/10.1128/JCM.01690-13 pmid: 24088862
44 Knight DR, Elliott B, Chang BJ, Perkins TT, Riley TV. Diversity and evolution in the genome of Clostridium difficile. Clin Microbiol Rev 2015; 28(3): 721–741
https://doi.org/10.1128/CMR.00127-14 pmid: 26085550
45 Yan Q, Zhang J, Chen C, Zhou H, Du P, Cui Z, Cen R, Liu L, Li W, Cao B, Lu J, Cheng Y. Multilocus sequence typing (MLST) analysis of 104 Clostridium difficile strains isolated from China. Epidemiol Infect 2013; 141(1): 195–199
https://doi.org/10.1017/S0950268812000453 pmid: 22475233
46 Chen YB, Gu SL, Wei ZQ, Shen P, Kong HS, Yang Q, Li LJ. Molecular epidemiology of Clostridium difficile in a tertiary hospital of China. J Med Microbiol 2014; 63(Pt 4): 562–569
https://doi.org/10.1099/jmm.0.068668-0 pmid: 24344206
47 Huang H, Wu S, Chen R, Xu S, Fang H, Weintraub A, Nord CE. Risk factors of Clostridium difficile infections among patients in a university hospital in Shanghai, China. Anaerobe 2014; 30: 65–69
https://doi.org/10.1016/j.anaerobe.2014.08.015 pmid: 25219941
48 Lihua Z, Danfeng D, Cen J, Xuefeng W, Yibing P. Clinical characterization and risk factors of Clostridium difficile infection in elderly patients in a Chinese hospital. J Infect Dev Ctries 2015; 9(4): 381–387
https://doi.org/10.3855/jidc.4816 pmid: 25881527
49 Wang P, Zhou Y, Wang Z, Xie S, Zhang T, Lin M, Li R, Tan J, Chen Y, Jiang B. Identification of Clostridium difficile ribotype 027 for the first time in Mainland China. Infect Control Hosp Epidemiol 2014; 35(1): 95–98
https://doi.org/10.1086/674405 pmid: 24334809
50 Deak E, Miller SA, Humphries RM. Comparison of Illumigene, Simplexa, and AmpliVue Clostridium difficile molecular assays for diagnosis of C. difficile infection. J Clin Microbiol 2014; 52(3): 960–963
https://doi.org/10.1128/JCM.02354-13 pmid: 24352999
51 Spina A, Kerr KG, Cormican M, Barbut F, Eigentler A, Zerva L, Tassios P, Popescu GA, Rafila A, Eerola E, Batista J, Maass M, Aschbacher R, Olsen KE, Allerberger F. Spectrum of enteropathogens detected by the FilmArray GI Panel in a multicentre study of community-acquired gastroenteritis. Clin Microbiol Infect 2015; 21(8): 719–728
https://doi.org/10.1016/j.cmi.2015.04.007 pmid: 25908431
52 Pallis A, Jazayeri J, Ward P, Dimovski K, Svobodova S. Rapid detection of Clostridium difficile toxins from stool samples using real-time multiplex PCR. J Med Microbiol 2013; 62(Pt 9): 1350–1356
https://doi.org/10.1099/jmm.0.058339-0 pmid: 23788597
53 Jensen MB, Olsen KE, Nielsen XC, Hoegh AM, Dessau RB, Atlung T, Engberg J. Diagnosis of Clostridium difficile: real-time PCR detection of toxin genes in faecal samples is more sensitive compared to toxigenic culture. Eur J Clin Microbiol Infect Dis 2015; 34(4): 727–736
https://doi.org/10.1007/s10096-014-2284-7 pmid: 25421216
54 Guilbault C, Labbé AC, Poirier L, Busque L, Béliveau C, Laverdière M. Development and evaluation of a PCR method for detection of the Clostridium difficile toxin B gene in stool specimens. J Clin Microbiol 2002; 40(6): 2288–2290
https://doi.org/10.1128/JCM.40.6.2288-2290.2002 pmid: 12037113
55 Gilbreath JJ, Verma P, Abbott AN, Butler-Wu SM. Comparison of the Verigene Clostridium difficile, Simplexa C. difficile Universal Direct, BD MAX Cdiff, and Xpert C. difficile assays for the detection of toxigenic C. difficile. Diagn Microbiol Infect Dis 2014; 80(1): 13–18
https://doi.org/10.1016/j.diagmicrobio.2014.06.001 pmid: 25027069
56 Hirvonen JJ, Kaukoranta SS. Comparison of BD Max Cdiff and GenomEra C. difficile molecular assays for detection of toxigenic Clostridium difficile from stools in conventional sample containers and in FecalSwabs. Eur J Clin Microbiol Infect Dis 2015; 34(5): 1005–1009
https://doi.org/10.1007/s10096-015-2320-2 pmid: 25616552
57 Persson S, Jensen JN, Olsen KE. Multiplex PCR method for detection of Clostridium difficile tcdA, tcdB, cdtA, and cdtB and internal in-frame deletion of tcdC. J Clin Microbiol 2011; 49(12): 4299–4300
https://doi.org/10.1128/JCM.05161-11 pmid: 21976756
58 Spigaglia P. Recent advances in the understanding of antibiotic resistance in Clostridium difficile infection. Ther Adv Infect Dis 2016; 3(1): 23–42
https://doi.org/10.1177/2049936115622891 pmid: 26862400
59 Spigaglia P, Barbanti F, Mastrantonio P. Tetracycline resistance gene tet(W) in the pathogenic bacterium Clostridium difficile. Antimicrob Agents Chemother 2008; 52(2): 770–773
https://doi.org/10.1128/AAC.00957-07 pmid: 18070963
60 Spigaglia P, Barbanti F, Mastrantonio P, Brazier JS, Barbut F, Delmée M, Kuijper E, Poxton IR; European Study Group on Clostridium difficile (ESGCD). Fluoroquinolone resistance in Clostridium difficile isolates from a prospective study of C. difficile infections in Europe. J Med Microbiol 2008; 57(Pt 6): 784–789
https://doi.org/10.1099/jmm.0.47738-0 pmid: 18480338
61 Jalal H, Stephen H, Curran MD, Burton J, Bradley M, Carne C. Development and validation of a rotor-gene real-time PCR assay for detection, identification, and quantification of Chlamydia trachomatis in a single reaction. J Clin Microbiol 2006; 44(1): 206–213
https://doi.org/10.1128/JCM.44.1.206-213.2006 pmid: 16390971
62 Jin DZ, Wen SY, Chen SH, Lin F, Wang SQ. Detection and identification of intestinal pathogens in clinical specimens using DNA microarrays. Mol Cell Probes 2006; 20(6): 337–347
https://doi.org/10.1016/j.mcp.2006.03.005 pmid: 16730943
63 Tringe SG, Hugenholtz P. A renaissance for the pioneering 16S rRNA gene. Curr Opin Microbiol 2008; 11(5): 442–446
https://doi.org/10.1016/j.mib.2008.09.011 pmid: 18817891
64 Cohen SH, Gerding DN, Johnson S, Kelly CP, Loo VG, McDonald LC, Pepin J, Wilcox MH; Society for Healthcare Epidemiology of America; Infectious Diseases Society of America. Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the society for healthcare epidemiology of America (SHEA) and the infectious diseases society of America (IDSA). Infect Control Hosp Epidemiol 2010;31(5):431–455
https://doi.org/10.1086/651706
[1] Shujian Deng, Xin Zhang, Wen Yan, Eric I-Chao Chang, Yubo Fan, Maode Lai, Yan Xu. Deep learning in digital pathology image analysis: a survey[J]. Front. Med., 2020, 14(4): 470-487.
[2] Kuo Yang, Runshun Zhang, Liyun He, Yubing Li, Wenwen Liu, Changhe Yu, Yanhong Zhang, Xinlong Li, Yan Liu, Weiming Xu, Xuezhong Zhou, Baoyan Liu. Multistage analysis method for detection of effective herb prescription from clinical data[J]. Front. Med., 2018, 12(2): 206-217.
[3] Hongbing Shen. Low-dose CT for lung cancer screening: opportunities and challenges[J]. Front. Med., 2018, 12(1): 116-121.
[4] Li Shang, Mingrong Wang. Molecular alterations and clinical relevance in esophageal squamous cell carcinoma[J]. Front Med, 2013, 7(4): 401-410.
[5] Jin Gao, Ben Panizza, Newell W. Johnson, Scott Coman, Alan R. Clough. Basic consideration of research strategies for head and neck cancer[J]. Front Med, 2012, 6(4): 339-353.
[6] Shi-Ming CHENG MD, Yu-Ji LAI MS, Er-Yong LIU MS, Lin ZHOU MD, Xue-Jing WANG MS, Qiu-Lan CHEN MS, Dong-Ming LI MS, Ning WANG MD, . Study on factors affecting TB/HIV co-infection in four counties of China[J]. Front. Med., 2010, 4(2): 185-191.
[7] Qiong YU PhD, Xiang-Fei MENG PhD, Jie-Ping SHI, Ya-Qin YU PhD, . Genetic association between the polymorphism of cytosolic PLA2 gene family and schizophrenia[J]. Front. Med., 2010, 4(1): 101-105.
[8] Wen-Qiang CHEN MD, Yun ZHANG MD, PhD, FACC, . Molecular mechanisms and therapeutic strategies of vulnerable atherosclerotic plaques[J]. Front. Med., 2010, 4(1): 36-42.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed