Please wait a minute...
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

邮发代号 80-967

2019 Impact Factor: 3.421

Frontiers of Medicine  2021, Vol. 15 Issue (2): 313-329   https://doi.org/10.1007/s11684-020-0737-1
  本期目录
H. sinensis mycelium inhibits epithelial--mesenchymal transition by inactivating the midkine pathway in pulmonary fibrosis
Li Lu1, Haiyan Zhu1, Hailin Wang1, Huaping Liang3(), Yayi Hou1,2,4(), Huan Dou1,2,4()
1. The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology, Medical School, Nanjing University, Nanjing 210093, China
2. Department of Rheumatology and Immunology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing 210008, China
3. State Key Laboratory of Trauma, Burns and Combined Injury, Research Institute of Surgery, Daping Hospital, The Army Medical University, Chongqing 400042, China
4. Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing 210093, China
 全文: PDF(10974 KB)   HTML
Abstract

The medical fungus Hirsutella sinensis has been used as a Chinese folk health supplement because of its immunomodulatory properties. Our previous studies established the antifibrotic action of Hirsutella sinensis mycelium (HSM) in the lung. The epithelial–mesenchymal transition (EMT) is involved in the pathogenesis of idiopathic pulmonary fibrosis. The present study investigates the role of HSM in mediating EMT during the development of pulmonary fibrosis. HSM significantly inhibits bleomycin (BLM)-induced pulmonary fibrosis by blocking the EMT. In addition, the expression levels of midkine are increased in the lungs of the BLM-induced group. Further analysis of the results indicates that the mRNA level of midkine correlated positively with EMT. HSM markedly abrogates the transforming growth factor β-induced EMT-like phenotype and behavior in vitro. The activation of midkine related signaling pathway is ameliorated following HSM treatment, whereas this extract also caused an effective attenuation of the induction of EMT (caused by midkine overexpression) in vitro. Results further confirm that oral medication of HSM disrupted the midkine pathway in vivo. Overall, findings suggest that the midkine pathway and the regulation of the EMT may be considered novel candidate therapeutic targets for the antifibrotic effects caused by HSM.

Key wordsepithelial–mesenchymal transition    H. sinensis mycelium    midkine    pulmonary fibrosis
收稿日期: 2019-06-02      出版日期: 2021-04-23
Corresponding Author(s): Huaping Liang,Yayi Hou,Huan Dou   
 引用本文:   
. [J]. Frontiers of Medicine, 2021, 15(2): 313-329.
Li Lu, Haiyan Zhu, Hailin Wang, Huaping Liang, Yayi Hou, Huan Dou. H. sinensis mycelium inhibits epithelial--mesenchymal transition by inactivating the midkine pathway in pulmonary fibrosis. Front. Med., 2021, 15(2): 313-329.
 链接本文:  
https://academic.hep.com.cn/fmd/CN/10.1007/s11684-020-0737-1
https://academic.hep.com.cn/fmd/CN/Y2021/V15/I2/313
Forward (5′−3′) Reverse (5′−3′)
Midkine CGCGGTCGCCAAAAAGAAAG TACTTGCAGTCGGCTCCAAAC
h-NOX1 TTGTTTGGTTAGGGCTGAATGT GCCAATGTTGACCCAAGGATTTT
h-Notch2 CCTTCCACTGTGAGTGTCTGA AGGTAGCATCATTCTGGCAGG
h-ACE GGAGGAATATGACCGGACATCC TGGTTGGCTATTTGCATGTTCTT
h-vimentin GCCCTAGACGAACTGGGTC GGCTGCAACTGCCTAATGAG
h-E-cadherin CGAGAGCTACA-CGTTCACGG CGAGAGCTACACGTTCACGG
h-GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC
h-N-cadherin TTTGATGGAGGTCTCCTAACACC ACGTTTAACACGTTGGAAATGTG
m-vimentin CGTCCACACGCACCTACAG GGGGGATGAGGAATAGAGGCT
m-E-cadherin GTGCAGGTGTCCGATGTCAA GGAGATTAACGAGGAGAGTGGC
m-N-cadherin AGGCTTCTGGTGAAATTGCAT GTCCACCTTGAAATCTGCTGG
m-NOX1 GCTGGATTTGAGAGCGTTGC GGTGGTATCTAGGGCTATGCT
mNotch2 GAGAAAAACCGCTGTCAGAATGG GGTGGAGTATTGGCAGTCCTC
mACE ATGACAAGCGACTTCTCCCC CCAAACCGAGGACCCCATAGA
mGAPDH AACGACCCCTTCATTGAC TCCACGACATACTCAGCAC
Tab.1  
Fig.1  
Fig.2  
Fig.3  
Fig.4  
Fig.5  
Fig.6  
Fig.7  
Fig.8  
1 L Richeldi, HR Collard, MG Jones. Idiopathic pulmonary fibrosis. Lancet 2017; 389(10082): 1941–1952
https://doi.org/10.1016/S0140-6736(17)30866-8 pmid: 28365056
2 SL Barratt, A Creamer, C Hayton, N Chaudhuri. Idiopathic pulmonary fibrosis (IPF): an overview. J Clin Med 2018; 7(8): E201
https://doi.org/10.3390/jcm7080201 pmid: 30082599
3 M Funke, T Geiser. Idiopathic pulmonary fibrosis: the turning point is now! Swiss Med Wkly 2015; 145: w14139
https://doi.org/10.4414/smw.2015.14139 pmid: 26024356
4 ES Kim, GM Keating. Pirfenidone: a review of its use in idiopathic pulmonary fibrosis. Drugs 2015; 75(2): 219–230
https://doi.org/10.1007/s40265-015-0350-9 pmid: 25604027
5 L Richeldi, RM du Bois, G Raghu, A Azuma, KK Brown, U Costabel, V Cottin, KR Flaherty, DM Hansell, Y Inoue, DS Kim, M Kolb, AG Nicholson, PW Noble, M Selman, H Taniguchi, M Brun, F Le Maulf, M Girard, S Stowasser, R Schlenker-Herceg, B Disse, HR Collard; INPULSIS Trial Investigators. Efficacy and safety of nintedanib in idiopathic pulmonary fibrosis. N Engl J Med 2014; 370(22): 2071–2082
https://doi.org/10.1056/NEJMoa1402584 pmid: 24836310
6 KC Meyer, CA Decker. Role of pirfenidone in the management of pulmonary fibrosis. Ther Clin Risk Manag 2017; 13: 427–437
https://doi.org/10.2147/TCRM.S81141 pmid: 28435277
7 L Richeldi, V Cottin, KR Flaherty, M Kolb, Y Inoue, G Raghu, H Taniguchi, DM Hansell, AG Nicholson, F Le Maulf, S Stowasser, HR Collard. Design of the INPULSIS™ trials: two phase 3 trials of nintedanib in patients with idiopathic pulmonary fibrosis. Respir Med 2014; 108(7): 1023–1030
https://doi.org/10.1016/j.rmed.2014.04.011 pmid: 24834811
8 A Hajari Case, P Johnson. Clinical use of nintedanib in patients with idiopathic pulmonary fibrosis. BMJ Open Respir Res 2017; 4(1): e000192
https://doi.org/10.1136/bmjresp-2017-000192 pmid: 28883926
9 JS Zhu, GM Halpern, K Jones. The scientific rediscovery of an ancient Chinese herbal medicine: Cordyceps sinensis: part I. J Altern Complement Med 1998; 4(3): 289–303
https://doi.org/10.1089/acm.1998.4.3-289 pmid: 9764768
10 JS Zhu, GM Halpern, K Jones. The scientific rediscovery of a precious ancient Chinese herbal regimen: Cordyceps sinensis: part II. J Altern Complement Med 1998; 4(4): 429–457
https://doi.org/10.1089/acm.1998.4.429 pmid: 9884180
11 TT Huang, KY Chong, DM Ojcius, YH Wu, YF Ko, CY Wu, J Martel, CC Lu, HC Lai, JD Young. Hirsutella sinensis mycelium suppresses interleukin-1b and interleukin-18 secretion by inhibiting both canonical and non-canonical inflammasomes. Sci Rep 2013; 3(1): 1374
https://doi.org/10.1038/srep01374 pmid: 23459183
12 TT Huang, HC Lai, YF Ko, DM Ojcius, YW Lan, J Martel, JD Young, KY Chong. Hirsutella sinensis mycelium attenuates bleomycin-induced pulmonary inflammation and fibrosis in vivo. Sci Rep 2015; 5(1): 15282
https://doi.org/10.1038/srep15282 pmid: 26497260
13 JH Koh, KW Yu, HJ Suh, YM Choi, TS Ahn. Activation of macrophages and the intestinal immune system by an orally administered decoction from cultured mycelia of Cordyceps sinensis. Biosci Biotechnol Biochem 2002; 66(2): 407–411
https://doi.org/10.1271/bbb.66.407 pmid: 11999417
14 SL Nordin, S Jovic, A Kurut, C Andersson, A Gela, A Bjartell, M M�rgelin, AI Olin, M Lund, A Egesten. High expression of midkine in the airways of patients with cystic fibrosis. Am J Respir Cell Mol Biol 2013; 49(6): 935–942
https://doi.org/10.1165/rcmb.2013-0106OC pmid: 23815177
15 QY Shou, HY Fu, LZ Zhang, YQ Cai, FM Chen, ML Chen. Study on treatment effect and mechanism of Hirsutella sinensis mycelium in idiopathic pulmonary fibrosis in rats. China J Chin Mater Med (Zhongguo Zhong Yao Za Zhi) 2012; 37(23): 3618–3623 (in Chinese)
16 H Yue, Y Zhao, H Wang, F Ma, F Liu, S Shen, Y Hou, H Dou. Anti-fibrosis effect for Hirsutella sinensis mycelium based on inhibition of mTOR p70S6K phosphorylation. Innate Immun 2017; 23(7): 615–624
https://doi.org/10.1177/1753425917726361 pmid: 28836874
17 B Chen, HR Cai, S Xue, WJ You, B Liu, HD Jiang. Bile acids induce activation of alveolar epithelial cells and lung fibroblasts through farnesoid X receptor-dependent and independent pathways. Respirology 2016; 21(6): 1075–1080
https://doi.org/10.1111/resp.12815 pmid: 27185272
18 SL O’Beirne, SM Walsh, A Fabre, C Reviriego, JC Worrell, IP Counihan, RV Lumsden, J Cramton-Barnes, JA Belperio, SC Donnelly, D Boylan, J Marchal-Sommé, R Kane, MP Keane. CXCL9 regulates TGF-b1-induced epithelial to mesenchymal transition in human alveolar epithelial cells. J Immunol 2015; 195(6): 2788–2796
https://doi.org/10.4049/jimmunol.1402008 pmid: 26268659
19 YC Wang, JS Liu, HK Tang, J Nie, JX Zhu, LL Wen, QL Guo. miR221 targets HMGA2 to inhibit bleomycininduced pulmonary fibrosis by regulating TGFb1/Smad3-induced EMT. Int J Mol Med 2016; 38(4): 1208–1216
https://doi.org/10.3892/ijmm.2016.2705 pmid: 27513632
20 BC Willis, Z Borok. TGF-b-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol 2007; 293(3): L525–L534 doi:10.1152/ajplung.00163.2007
pmid: 17631612
21 H Kage, Z Borok. EMT and interstitial lung disease: a mysterious relationship. Curr Opin Pulm Med 2012; 18(5): 517–523 doi:10.1097/MCP.0b013e3283566721
pmid: 22854509
22 X Xiao, C Huang, C Zhao, X Gou, LK Senavirathna, M Hinsdale, P Lloyd, L Liu. Regulation of myofibroblast differentiation by miR-424 during epithelial-to-mesenchymal transition. Arch Biochem Biophys 2015; 566: 49–57
https://doi.org/10.1016/j.abb.2014.12.007 pmid: 25524739
23 H Zhang, M Okamoto, E Panzhinskiy, WM Zawada, M Das. PKCd/midkine pathway drives hypoxia-induced proliferation and differentiation of human lung epithelial cells. Am J Physiol Cell Physiol 2014; 306(7): C648–C658
https://doi.org/10.1152/ajpcell.00351.2013 pmid: 24500281
24 LT Weckbach, KT Preissner, E Deindl. The role of midkine in arteriogenesis, involving mechanosensing, endothelial cell proliferation, and vasodilation. Int J Mol Sci 2018; 19(9): E2559
https://doi.org/10.3390/ijms19092559 pmid: 30158425
25 T Masuda, K Maeda, W Sato, T Kosugi, Y Sato, H Kojima, N Kato, T Ishimoto, N Tsuboi, K Uchimura, Y Yuzawa, S Maruyama, K Kadomatsu. Growth factor midkine promotes T-cell activation through nuclear factor of activated T cells signaling and Th1 cell differentiation in lupus nephritis. Am J Pathol 2017; 187(4): 740–751
https://doi.org/10.1016/j.ajpath.2016.12.006 pmid: 28183532
26 TA Mitsiadis, T Muramatsu, H Muramatsu, I Thesleff. Midkine (MK), a heparin-binding growth/differentiation factor, is regulated by retinoic acid and epithelial-mesenchymal interactions in the developing mouse tooth, and affects cell proliferation and morphogenesis. J Cell Biol 1995; 129(1): 267–281
https://doi.org/10.1083/jcb.129.1.267 pmid: 7698992
27 S Erdogan, K Turkekul, I Dibirdik, O Doganlar, ZB Doganlar, A Bilir, G Oktem. Midkine downregulation increases the efficacy of quercetin on prostate cancer stem cell survival and migration through PI3K/AKT and MAPK/ERK pathway. Biomed Pharmacother 2018; 107: 793–805
https://doi.org/10.1016/j.biopha.2018.08.061 pmid: 30142541
28 FM Vieceli, ME Bronner. Leukocyte receptor tyrosine kinase interacts with secreted midkine to promote survival of migrating neural crest cells. Development 2018; 145(20): dev164046
https://doi.org/10.1242/dev.164046 pmid: 30228102
29 N Konishi, M Nakamura, S Nakaoka, Y Hiasa, M Cho, H Uemura, Y Hirao, T Muramatsu, K Kadomatsu. Immunohistochemical analysis of midkine expression in human prostate carcinoma. Oncology 1999; 57(3): 253–257
https://doi.org/10.1159/000012039 pmid: 10545795
30 S Netsu, T Shishido, T Kitahara, Y Honda, A Funayama, T Narumi, S Kadowaki, H Takahashi, T Miyamoto, T Arimoto, S Nishiyama, T Watanabe, CH Woo, Y Takeishi, I Kubota. Midkine exacerbates pressure overload-induced cardiac remodeling. Biochem Biophys Res Commun 2014; 443(1): 205–210
https://doi.org/10.1016/j.bbrc.2013.11.083 pmid: 24291499
31 SL Nordin, S Jovic, A Kurut, C Andersson, A Gela, A Bjartell, M M�rgelin, AI Olin, M Lund, A Egesten. High expression of midkine in the airways of patients with cystic fibrosis. Am J Respir Cell Mol Biol 2013; 49(6): 935–942
https://doi.org/10.1165/rcmb.2013-0106OC pmid: 23815177
32 II Siempos, AM Choi. Midkine: in the middle of the pathogenesis of acute respiratory distress syndrome-associated lung fibrosis? Am J Respir Crit Care Med 2015; 192(3): 271–272
https://doi.org/10.1164/rccm.201506-1084ED pmid: 26230229
33 R Zhang, Y Pan, V Fanelli, S Wu, AA Luo, D Islam, B Han, P Mao, M Ghazarian, W Zeng, PM Spieth, D Wang, J Khang, H Mo, X Liu, S Uhlig, M Liu, J Laffey, AS Slutsky, Y Li, H Zhang. Mechanical stress and the induction of lung fibrosis via the midkine signaling pathway. Am J Respir Crit Care Med 2015; 192(3): 315–323
https://doi.org/10.1164/rccm.201412-2326OC pmid: 25945397
34 C G�ng�r, H Zander, KE Effenberger, YK Vashist, T Kalinina, JR Izbicki, E Yekebas, M Bockhorn. Notch signaling activated by replication stress-induced expression of midkine drives epithelial-mesenchymal transition and chemoresistance in pancreatic cancer. Cancer Res 2011; 71(14): 5009–5019
https://doi.org/10.1158/0008-5472.CAN-11-0036 pmid: 21632553
35 G Zhao, Y Nie, M Lv, L He, T Wang, Y Hou. ERb-mediated estradiol enhances epithelial mesenchymal transition of lung adenocarcinoma through increasing transcription of midkine. Mol Endocrinol 2012; 26(8): 1304–1315
https://doi.org/10.1210/me.2012-1028 pmid: 22669742
36 Y Huang, MO Hoque, F Wu, B Trink, D Sidransky, EA Ratovitski. Midkine induces epithelial-mesenchymal transition through Notch2/Jak2-Stat3 signaling in human keratinocytes. Cell Cycle 2008; 7(11): 1613–1622
https://doi.org/10.4161/cc.7.11.5952 pmid: 18469519
37 K Misa, Y Tanino, X Wang, T Nikaido, M Kikuchi, Y Sato, R Togawa, M Tanino, S Tanaka, K Kadomatsu, M Munakata. Involvement of midkine in the development of pulmonary fibrosis. Physiol Rep 2017; 5(16): e13383
https://doi.org/10.14814/phy2.13383 pmid: 28811360
38 QL Wang, H Wang, SL Zhao, YH Huang, YY Hou. Over-expressed and truncated midkines promote proliferation of BGC823 cells in vitro and tumor growth in vivo. World J Gastroenterol 2008; 14(12): 1858–1865
https://doi.org/10.3748/wjg.14.1858 pmid: 18350623
39 K Rajasekaran, V Xiong, L Fong, J Gorski, S Malarkannan. Functional dichotomy between NKG2D and CD28-mediated co-stimulation in human CD8+ T cells. PLoS One 2010; 5(9): e12635
https://doi.org/10.1371/journal.pone.0012635 pmid: 20844584
40 A Gardner, AJ Fisher, C Richter, GE Johnson, EJ Moisey, M Brodlie, C Ward, A Krippner-Heidenreich, DA Mann, LA Borthwick. The critical role of TAK1 in accentuated epithelial to mesenchymal transition in obliterative bronchiolitis after lung transplantation. Am J Pathol 2012; 180(6): 2293–2308
https://doi.org/10.1016/j.ajpath.2012.02.022 pmid: 22525462
41 R Tian, Y Zhu, J Yao, X Meng, J Wang, H Xie, R Wang. NLRP3 participates in the regulation of EMT in bleomycin-induced pulmonary fibrosis. Exp Cell Res 2017; 357(2): 328–334
https://doi.org/10.1016/j.yexcr.2017.05.028 pmid: 28591554
42 S Vyas-Read, W Wang, S Kato, J Colvocoresses-Dodds, NH Fifadara, TW Gauthier, MN Helms, DP Carlton, LA Brown. Hyperoxia induces alveolar epithelial-to-mesenchymal cell transition. Am J Physiol Lung Cell Mol Physiol 2014; 306(4): L326–L340
https://doi.org/10.1152/ajplung.00074.2013 pmid: 24375795
43 N Suzuki, Y Shibata, T Urano, T Murohara, T Muramatsu, K Kadomatsu. Proteasomal degradation of the nuclear targeting growth factor midkine. J Biol Chem 2004; 279(17): 17785–17791
https://doi.org/10.1074/jbc.M310772200 pmid: 14970216
44 SH Phan. The myofibroblast in pulmonary fibrosis. Chest 2002; 122(6 Suppl): 286S–289S
https://doi.org/10.1378/chest.122.6_suppl.286S pmid: 12475801
45 H Zhao, QQ Wu, LF Cao, HY Qing, C Zhang, YH Chen, H Wang, RY Liu, DX Xu. Melatonin inhibits endoplasmic reticulum stress and epithelial-mesenchymal transition during bleomycin-induced pulmonary fibrosis in mice. PLoS One 2014; 9(5): e97266
https://doi.org/10.1371/journal.pone.0097266 pmid: 24818755
46 AS Marudamuthu, YP Bhandary, SK Shetty, J Fu, V Sathish, Y Prakash, S Shetty. Role of the urokinase-fibrinolytic system in epithelial-mesenchymal transition during lung injury. Am J Pathol 2015; 185(1): 55–68
https://doi.org/10.1016/j.ajpath.2014.08.027 pmid: 25447049
47 SY Kyung, DY Kim, JY Yoon, ES Son, YJ Kim, JW Park, SH Jeong. Sulforaphane attenuates pulmonary fibrosis by inhibiting the epithelial-mesenchymal transition. BMC Pharmacol Toxicol 2018; 19(1): 13
https://doi.org/10.1186/s40360-018-0204-7 pmid: 29609658
48 KK Kim, MC Kugler, PJ Wolters, L Robillard, MG Galvez, AN Brumwell, D Sheppard, HA Chapman. Alveolar epithelial cell mesenchymal transition develops in vivo during pulmonary fibrosis and is regulated by the extracellular matrix. Proc Natl Acad Sci USA 2006; 103(35): 13180–13185
https://doi.org/10.1073/pnas.0605669103 pmid: 16924102
49 R Kalluri, EG Neilson. Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest 2003; 112(12): 1776–1784
https://doi.org/10.1172/JCI200320530 pmid: 14679171
50 H Tanjore, XC Xu, VV Polosukhin, AL Degryse, B Li, W Han, TP Sherrill, D Plieth, EG Neilson, TS Blackwell, WE Lawson. Contribution of epithelial-derived fibroblasts to bleomycin-induced lung fibrosis. Am J Respir Crit Care Med 2009; 180(7): 657–665
https://doi.org/10.1164/rccm.200903-0322OC pmid: 19556518
51 KK Kim, Y Wei, C Szekeres, MC Kugler, PJ Wolters, ML Hill, JA Frank, AN Brumwell, SE Wheeler, JA Kreidberg, HA Chapman. Epithelial cell a3b1 integrin links b-catenin and Smad signaling to promote myofibroblast formation and pulmonary fibrosis. J Clin Invest 2009; 119(1): 213–224
pmid: 19104148
52 Y Huang, MO Hoque, F Wu, B Trink, D Sidransky, EA Ratovitski. Midkine induces epithelial-mesenchymal transition through Notch2/Jak2-Stat3 signaling in human keratinocytes. Cell Cycle 2008; 7(11): 1613–1622
https://doi.org/10.4161/cc.7.11.5952 pmid: 18469519
53 K Misa, Y Tanino, X Wang, T Nikaido, M Kikuchi, Y Sato, R Togawa, M Tanino, S Tanaka, K Kadomatsu, M Munakata. Involvement of midkine in the development of pulmonary fibrosis. Physiol Rep 2017; 5(16): e13383
https://doi.org/10.14814/phy2.13383 pmid: 28811360
54 F Liu, AM Gomez Garcia, FL Meyskens Jr. NADPH oxidase 1 overexpression enhances invasion via matrix metalloproteinase-2 and epithelial-mesenchymal transition in melanoma cells. J Invest Dermatol 2012; 132(8): 2033–2041
https://doi.org/10.1038/jid.2012.119 pmid: 22513785
55 D Kesanakurti, D Maddirela, YK Banasavadi-Siddegowda, TH Lai, Z Qamri, NK Jacob, D Sampath, S Mohanam, B Kaur, VK Puduvalli. A novel interaction of PAK4 with PPARg to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma. Oncogene 2017; 36(37): 5309–5320
https://doi.org/10.1038/onc.2016.261 pmid: 28534509
56 SJ Das, FJ Lovicu, EJ Collinson. Nox4 plays a role in TGF-b-dependent lens epithelial to mesenchymal transition. Invest Ophthalmol Vis Sci 2016; 57(8): 3665–3673
https://doi.org/10.1167/iovs.16-19114 pmid: 27403995
57 YK Rao, SH Fang, YM Tzeng. Evaluation of the anti-inflammatory and anti-proliferation tumoral cells activities of Antrodia camphorata, Cordyceps sinensis, and Cinnamomum osmophloeum bark extracts. J Ethnopharmacol 2007; 114(1): 78–85
https://doi.org/10.1016/j.jep.2007.07.028 pmid: 17822865
58 YF Ko, JC Liau, CS Lee, CY Chiu, J Martel, CS Lin, SF Tseng, DM Ojcius, CC Lu, HC Lai, JD Young. Isolation, culture and characterization of Hirsutella sinensis mycelium from Caterpillar fungus fruiting body. PLoS One 2017; 12(1): e0168734
https://doi.org/10.1371/journal.pone.0168734 pmid: 28046129
59 A Datta, GA Kim, JM Taylor, SF Gugino, KN Farrow, PT Schumacker, SK Berkelhamer. Mouse lung development and NOX1 induction during hyperoxia are developmentally regulated and mitochondrial ROS dependent. Am J Physiol Lung Cell Mol Physiol 2015; 309(4): L369–L377
https://doi.org/10.1152/ajplung.00176.2014 pmid: 26092998
60 F Zanetti, M Giacomello, Y Donati, S Carnesecchi, M Frieden, C Barazzone-Argiroffo. Nicotine mediates oxidative stress and apoptosis through cross talk between NOX1 and Bcl-2 in lung epithelial cells. Free Radic Biol Med 2014; 76: 173–184
https://doi.org/10.1016/j.freeradbiomed.2014.08.002 pmid: 25151121
[1] FMD-19046-OF-DH_suppl_1 Download
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed