Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Materials Science

ISSN 2095-025X

ISSN 2095-0268(Online)

CN 11-5985/TB

Postal Subscription Code 80-974

2018 Impact Factor: 1.701

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Mater. Sci.    2016, Vol. 10 Issue (3) : 260-269    https://doi.org/10.1007/s11706-016-0348-6
RESEARCH ARTICLE
Neurogenic differentiation of human umbilical cord mesenchymal stem cells on aligned electrospun polypyrrole/polylactide composite nanofibers with electrical stimulation
Junfeng ZHOU1,Liang CHENG1,Xiaodan SUN1,*(),Xiumei WANG1,*(),Shouhong JIN2,Junxiang LI2,Qiong WU2
1. Key Laboratory of Advanced Materials of Ministry of Education of China, School of Materials Science and Engineering, Tsinghua University, Beijing 100084, China
2. School of Life Sciences, Tsinghua University, Beijing 100084, China
 Download: PDF(439 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Adult central nervous system (CNS) tissue has a limited capacity to recover after trauma or disease. Recent medical cell therapy using polymeric biomaterial-loaded stem cells with the capability of differentiation to specific neural population has directed focuses toward the recovery of CNS. Fibers that can provide topographical, biochemical and electrical cues would be attractive for directing the differentiation of stem cells into electro-responsive cells such as neuronal cells. Here we report on the fabrication of an electrospun polypyrrole/polylactide composite nanofiber film that?direct or determine the fate of mesenchymal stem cells (MSCs), via combination of aligned surface topography, and electrical stimulation (ES). The surface morphology, mechanical properties and electric properties of the film were characterized. Comparing with that on random surface film, expression of neurofilament-lowest and nestin of human umbilical cord mesenchymal stem cells (huMSCs) cultured on film with aligned surface topography and ES were obviously enhanced. These results suggest that aligned topography combining with ES facilitates the neurogenic differentiation of huMSCs and the aligned conductive film can act as a potential nerve scaffold.
Keywords human umbilical cord mesenchymal stem cells      neurogenic differentiation      conductive composite film      electrospun nanofibers      electrical stimulation     
Corresponding Author(s): Xiaodan SUN,Xiumei WANG   
Online First Date: 04 July 2016    Issue Date: 08 August 2016
 Cite this article:   
Junfeng ZHOU,Liang CHENG,Xiaodan SUN, et al. Neurogenic differentiation of human umbilical cord mesenchymal stem cells on aligned electrospun polypyrrole/polylactide composite nanofibers with electrical stimulation[J]. Front. Mater. Sci., 2016, 10(3): 260-269.
 URL:  
https://academic.hep.com.cn/foms/EN/10.1007/s11706-016-0348-6
https://academic.hep.com.cn/foms/EN/Y2016/V10/I3/260
Fig.1  The illustration of electrical stimulation device: (a) top view; (b) side view.
Gene Primers
Nestin F: GTGACGGCACTCCCATGTGR: TTTTTGAAGCGGAGGCATTAC
NF-L F: ACCAGCGTGGGAAGCATAACR: GCGGGTGGACATCAGATAGG
ALP F: ACCACCACGAGAGTGAACCAR: CGTTGTCTGAGTACCAGTCCC
Runx2 F: TGGTTACTGTCATGGCGGGTAR: TCTCAGATCGTTGAACCTTGCTA
LPL F: TCATTCCCGGAGTAGCAGAGTR: GGCCACAAGTTTTGGCACC
Acta2 F: AAAAGACAGCTACGTGGGTGAR: GCCATGTTCTATCGGGTACTTC
Col2a1 F: TGGACGATCAGGCGAAACCR: GCTGCGGATGCTCTCAATCT
GAPDH F: AACGACCCCTTCATTGACR: TCCACGACATACTCAGCAC
Tab.1  Sequence of Primers for RT-PCR
Fig.2  The morphology and dimension of prepared PPy nanoparticles: (a) SEM image of PPy nanoparticles; (b) TEM image of single PPy nanoparticle; (c) histogram of PPy nanoparticles’ diameter distribution.
Fig.3  The characterization of PPy-embedded PLA composite electrospun nanofibers: (a) SEM image of random nanofibers; (b) SEM image of aligned nanofibers; (c) TEM image of electrospinning nanofibers embedded with PPy nanoparticles; (d) magnification of the square part in (c) showed the distribution of PPy particles in the fibers; (e) histogram of diameter distribution of the nanofibers; (f) illustration of current path formed by PPy in and between PLA fibers.
Fig.4  The mechanical properties of (a) Young’s modulus, (b) maximum tensile strength and (c) elongation at break of random PLA, random composite film, aligned composite film in axial direction and aligned composite film in radical direction.
Fig.5  DAPI-stained huMSCs on (a) PLA AF and (b) composite AF. (c) Calculated cell numbers of PLA AF and composite AF.
Fig.6  Laser scanning confocal microscope images of cells on (a) TCP, (b) composite RF, (c) composite AF, (d) composite RF+ES, and (e) composite AF+ES. White arrows indicate the directions of cells.
Fig.7  SEM images of cells on (a) TCP, (b) composite RF, (c) composite AF, (d) composite RF+ES, (e) composite AF+ES, and (f) composite RF in larger magnification. Red arrows indicate the direction of cells.
Fig.8  The RNA expression of huMSCs on films: (a) the expressions of NF-L, nes on TCP, composite RF, composite AF, composite AF+ES and PLA AF+ES groups; (b) the RNA expression of ALP, Runx2, LPL, acta2 and col2a1 on composite RF, composite AF and composite AF+ES groups.
Fig.9  The immunostaining of NF-L (green), DAPI (blue) for cells on (a) TCP, (b) random fiber film, (c) random fiber film with ES, (d) aligned fiber film, and (e) aligned fiber film with ES. The arrow indicates the neurite-like structure.
1 Liu X, Pi B, Wang H, . Self-assembling peptide nanofiber hydrogels for central nervous system regeneration. Frontiers of Materials Science, 2015, 9(1): 1–13
https://doi.org/10.1007/s11706-015-0274-z
2 He J, Wang X M, Spector M, . Scaffolds for central nervous system tissue engineering. Frontiers of Materials Science, 2012, 6(1): 1–25
https://doi.org/10.1007/s11706-012-0157-5
3 Bagher Z, Ebrahimi-Barough S, Azami M, . Cellular activity of Wharton’s Jelly-derived mesenchymal stem cells on electrospun fibrous and solvent-cast film scaffolds. Journal of Biomedical Materials Research Part A, 2016, 104(1): 218–226
https://doi.org/10.1002/jbm.a.35555 pmid: 26265047
4 Irani S, Zandi M, Salamian N, . The study of P19 stem cell behavior on aligned oriented electrospun poly(lactic-co-glycolic acid) nano-fibers for neural tissue engineering. Polymers for Advanced Technologies, 2014, 25(5): 562–567
https://doi.org/10.1002/pat.3280
5 Wang X, He J, Wang Y, . Hyaluronic acid-based scaffold for central neural tissue engineering. Interface Focus, 2012, 2(3): 278–291
https://doi.org/10.1098/rsfs.2012.0016 pmid: 23741606
6 Lu P, Blesch A, Tuszynski M H. Induction of bone marrow stromal cells to neurons: differentiation, transdifferentiation, or artifact? Journal of Neuroscience Research, 2004, 77(2): 174–191
https://doi.org/10.1002/jnr.20148 pmid: 15211585
7 Wang Y, Yao S, Meng Q, . Gene expression profiling and mechanism study of neural stem cells response to surface chemistry. Regenerative Biomaterials, 2014, 1(1): 37–47
https://doi.org/10.1093/rb/rbu012 pmid: 26816623
8 Liu X, Wang X, Wang X, . Functionalized self-assembling peptide nanofiber hydrogels mimic stem cell niche to control human adipose stem cell behavior in vitro. Acta Biomaterialia, 2013, 9(6): 6798–6805
https://doi.org/10.1016/j.actbio.2013.01.027 pmid: 23380207
9 Liu X, He J, Zhang S, . Adipose stem cells controlled by surface chemistry. Journal of Tissue Engineering and Regenerative Medicine, 2013, 7(2): 112–117
https://doi.org/10.1002/term.498 pmid: 22162249
10 Liu X, Wang Y, He J, . Various fates of neuronal progenitor cells observed on several different chemical functional groups. Frontiers of Materials Science, 2011, 5(4): 358–366
https://doi.org/10.1007/s11706-011-0150-4
11 Yao S L, Liu X, Wang X M, . Directing neural stem cell fate with biomaterial parameters for injured brain regeneration. Progress in Natural Science: Materials International, 2013, 23(2): 103–112
https://doi.org/10.1016/j.pnsc.2013.02.009
12 Zhang J G, Qiu K X, Sun B B, . The aligned core–sheath nanofibers with electrical conductivity for neural tissue engineering. Journal of Materials Chemistry B: Materials for Biology and Medicine, 2014, 2(45): 7945–7954
https://doi.org/10.1039/C4TB01185F
13 Lanfer B, Hermann A, Kirsch M, . Directed growth of adult human white matter stem cell-derived neurons on aligned fibrillar collagen. Tissue Engineering Part A, 2010, 16(4): 1103–1113
https://doi.org/10.1089/ten.tea.2009.0282 pmid: 19860550
14 Lim S H, Liu X Y, Song H, . The effect of nanofiber-guided cell alignment on the preferential differentiation of neural stem cells. Biomaterials, 2010, 31(34): 9031–9039
https://doi.org/10.1016/j.biomaterials.2010.08.021 pmid: 20797783
15 Çapkın M, Çakmak S, Kurt F O, . Random/aligned electrospun PCL/PCL-collagen nanofibrous membranes: comparison of neural differentiation of rat AdMSCs and BMSCs. Biomedical Materials, 2012, 7(4): 045013
https://doi.org/10.1088/1748-6041/7/4/045013 pmid: 22652636
16 Yao S, Liu X, Yu S, . Co-effects of matrix low elasticity and aligned topography on stem cell neurogenic differentiation and rapid neurite outgrowth. Nanoscale, 2016, 8(19): 10252–10265
https://doi.org/10.1039/C6NR01169A pmid: 27124547
17 Ghasemi-Mobarakeh L, Prabhakaran M P, Morshed M, . Application of conductive polymers, scaffolds and electrical stimulation for nerve tissue engineering. Journal of Tissue Engineering and Regenerative Medicine, 2011, 5(4): e17–e35
https://doi.org/10.1002/term.383 pmid: 21413155
18 Park S J, Park J S, Yang H N, . Neurogenesis is induced by electrical stimulation of human mesenchymal stem cells co-cultured with mature neuronal cells. Macromolecular Bioscience, 2015, 15(11): 1586–1594
https://doi.org/10.1002/mabi.201500115 pmid: 26183918
19 Thrivikraman G, Madras G, Basu B. Intermittent electrical stimuli for guidance of human mesenchymal stem cell lineage commitment towards neural-like cells on electroconductive substrates. Biomaterials, 2014, 35(24): 6219–6235
https://doi.org/10.1016/j.biomaterials.2014.04.018 pmid: 24816362
20 Park J S, Yang H N, Woo D G, . Exogenous Nurr1 gene expression in electrically-stimulated human MSCs and the induction of neurogenesis. Biomaterials, 2012, 33(29): 7300–7308
https://doi.org/10.1016/j.biomaterials.2012.06.069 pmid: 22800541
21 Prabhakaran M P, Ghasemi-Mobarakeh L, Jin G, . Electrospun conducting polymer nanofibers and electrical stimulation of nerve stem cells. Journal of Bioscience and Bioengineering, 2011, 112(5): 501–507
https://doi.org/10.1016/j.jbiosc.2011.07.010 pmid: 21813321
22 Piacentini R, Ripoli C, Mezzogori D, . Extremely low-frequency electromagnetic fields promote in vitro neurogenesis via upregulation of Cav1-channel activity. Journal of Cellular Physiology, 2008, 215(1): 129–139
https://doi.org/10.1002/jcp.21293 pmid: 17941084
23 Huang Y J, Wu H C, Tai N H, . Carbon nanotube rope with electrical stimulation promotes the differentiation and maturity of neural stem cells. Small, 2012, 8(18): 2869–2877
https://doi.org/10.1002/smll.201200715 pmid: 22753249
24 Gunewardene N, Dottori M, Nayagam B A. The convergence of cochlear implantation with induced pluripotent stem cell therapy. Stem Cell Reviews, 2012, 8(3): 741–754
https://doi.org/10.1007/s12015-011-9320-0 pmid: 21956409
25 Sauer H, Rahimi G, Hescheler J, . Effects of electrical fields on cardiomyocyte differentiation of embryonic stem cells. Journal of Cellular Biochemistry, 1999, 75(4): 710–723
https://doi.org/10.1002/(SICI)1097-4644(19991215)75:4<710::AID-JCB16>3.0.CO;2-Z pmid: 10572253
26 Balint R, Cassidy N J, Cartmell S H. Electrical stimulation: a novel tool for tissue engineering. Tissue Engineering Part B: Reviews, 2013, 19(1): 48–57
https://doi.org/10.1089/ten.teb.2012.0183 pmid: 22873689
27 Sheikh F A, Ju H W, Moon B M, . A comparative mechanical and biocompatibility study of poly(ε-caprolactone), hybrid poly(ε-caprolactone)-silk, and silk nanofibers by colloidal electrospinning technique for tissue engineering. Journal of Bioactive and Compatible Polymers, 2014, 29(5): 500–514
https://doi.org/10.1177/0883911514549717
28 Zhang H L. Effects of electrospinning parameters on morphology and diameter of electrospun PLGA/MWNTs fibers and cytocompatibility in vitro. Journal of Bioactive and Compatible Polymers, 2011, 26(6): 590–606
https://doi.org/10.1177/0883911511424015
29 Shi G, Rouabhia M, Wang Z, . A novel electrically conductive and biodegradable composite made of polypyrrole nanoparticles and polylactide. Biomaterials, 2004, 25(13): 2477–2488
https://doi.org/10.1016/j.biomaterials.2003.09.032 pmid: 14751732
30 Pelto J, Björninen M, Pälli A, . Novel polypyrrole-coated polylactide scaffolds enhance adipose stem cell proliferation and early osteogenic differentiation. Tissue Engineering Part A, 2013, 19(7‒8): 882–892
https://doi.org/10.1089/ten.tea.2012.0111 pmid: 23126228
31 Shi G, Zhang Z, Rouabhia M. The regulation of cell functions electrically using biodegradable polypyrrole–polylactide conductors. Biomaterials, 2008, 29(28): 3792–3798
https://doi.org/10.1016/j.biomaterials.2008.06.010 pmid: 18602689
32 Lee J Y, Bashur C A, Goldstein A S, . Polypyrrole-coated electrospun PLGA nanofibers for neural tissue applications. Biomaterials, 2009, 30(26): 4325–4335
https://doi.org/10.1016/j.biomaterials.2009.04.042 pmid: 19501901
33 Xie J, Macewan M R, Willerth S M, . Conductive core–sheath nanofibers and their potential application in neural tissue engineering. Advanced Functional Materials, 2009, 19(14): 2312–2318
https://doi.org/10.1002/adfm.200801904 pmid: 19830261
34 Sudwilai T, Ng J J, Boonkrai C, . Polypyrrole-coated electrospun poly(lactic acid) fibrous scaffold: effects of coating on electrical conductivity and neural cell growth. Journal of Biomaterials Science: Polymer Edition, 2014, 25(12): 1240–1252
https://doi.org/10.1080/09205063.2014.926578 pmid: 24933469
35 El Omar R, Beroud J, Stoltz J F, . Umbilical cord mesenchymal stem cells: the new gold standard for mesenchymal stem cell-based therapies? Tissue Engineering Part B: Reviews, 2014, 20(5): 523–544
https://doi.org/10.1089/ten.teb.2013.0664 pmid: 24552279
36 Zheng R, Sun X. Influence of template agent and oxidant on morphology and electrical conductivity of polypyrrole nano particles. Polymer Materials Science and Engineering, 2012, 28(12): 72–75, 80
37 Ghasemi-Mobarakeh L, Prabhakaran M P, Morshed M, . Electrical stimulation of nerve cells using conductive nanofibrous scaffolds for nerve tissue engineering. Tissue Engineering Part A, 2009, 15(11): 3605–3619
https://doi.org/10.1089/ten.tea.2008.0689 pmid: 19496678
38 Chung T W, Liu D Z, Wang S Y, . Enhancement of the growth of human endothelial cells by surface roughness at nanometer scale. Biomaterials, 2003, 24(25): 4655–4661
https://doi.org/10.1016/S0142-9612(03)00361-2 pmid: 12951008
39 Wu L P, You M L, Wang D Y, . Fabrication of carbon nanotube (CNT)/poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) nanocomposite films for human mesenchymal stem cell (hMSC) differentiation. Polymer Chemistry, 2013, 4(16): 4490–4498
https://doi.org/10.1039/c3py00668a
40 Yang A, Huang Z, Yin G, . Fabrication of aligned, porous and conductive fibers and their effects on cell adhesion and guidance. Colloids and Surfaces B: Biointerfaces, 2015, 134: 469–474
https://doi.org/10.1016/j.colsurfb.2015.07.028 pmid: 26258750
41 Au H T H, Cheng I, Chowdhury M F, . Interactive effects of surface topography and pulsatile electrical field stimulation on orientation and elongation of fibroblasts and cardiomyocytes. Biomaterials, 2007, 28(29): 4277–4293
https://doi.org/10.1016/j.biomaterials.2007.06.001 pmid: 17604100
[1] Chaoyuan LIU, Zhongbing HUANG, Ximing PU, Lei SHANG, Guangfu YIN, Xianchun CHEN, Shuang CHENG. Fabrication of carboxylic graphene oxide-composited polypyrrole film for neurite growth under electrical stimulation[J]. Front. Mater. Sci., 2019, 13(3): 258-269.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed