Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk

doi:10.15302/J-FASE-2018211

Frontiers of Agricultural Science and Engineering

2018, Vol. 5

Issue (3): 382-389 https://doi.org/10.15302/J-FASE-2018211

本期目录

Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk

Shen LIU¹, Shengzhe SHANG², Xuezhen YANG¹, Huihua ZHANG¹, Dan LU^2,³(

), Ning LI²(

)

¹. School of Life Science and Engineering, Foshan University, Foshan 528000, China
². State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100193, China
³. Shanghai Institute of Medical Genetics, Shanghai Children’s Hospital, Shanghai Jiao Tong University, Shanghai 200040, China

全文: PDF(844 KB) HTML

Abstract：

The mammary gland provides a novel method for producing recombinant proteins in milk of transgenic animals. A key component in the technology is the construction of an efficient milk expression vector. Here, we established a simple method to construct a milk expression vector, by a combination of homologous recombination and digestion-ligation. Our methodology is expected to have the advantages of both plasmid and bacterial artificial chromosome (BAC) vectors. The BAC of mouse whey acidic protein gene (mWAP) was modified twice by homologous recombination to produce a universal expression vector, and the human lysozyme gene (hLZ) was then inserted into the vector by a digestion-ligation method. The final vector containing the 8.5 kb mWAP 5′ promoter, 4.8 kb hLZ genomic DNA, and 8.0 kb mWAP 3′ genomic DNA was microinjected into pronuclei of fertilized mouse embryos, to successfully generate two transgenic mouse lines that expressed recombinant human lysozyme (rhLZ) in milk. The highest expression level of rhLZ was 0.45 g·L⁻¹, and rhLZ exhibited the same antibacterial activity as native hLZ. Our results have provided a simple approach to construct a universal milk expression vector, and demonstrated that the resulting vector regulates the expression of hLZ in milk.

Key words： BAC recombinant methods gene expression human lysozyme transgenic mice milk expression vector

收稿日期: 2017-10-31 出版日期: 2018-07-31

Corresponding Author(s): Dan LU,Ning LI

引用本文:

. [J]. Frontiers of Agricultural Science and Engineering, 2018, 5(3): 382-389.
Shen LIU, Shengzhe SHANG, Xuezhen YANG, Huihua ZHANG, Dan LU, Ning LI. Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk. Front. Agr. Sci. Eng. , 2018, 5(3): 382-389.

链接本文:

https://academic.hep.com.cn/fase/CN/10.15302/J-FASE-2018211
https://academic.hep.com.cn/fase/CN/Y2018/V5/I3/382

Primer	Primer sequence	Utility
PBR-F	5′–CACTAAGAATTTTATACATTCTCAGCTGGCTGTGGTGGTATGTCCACCACTGCAACCCTTcgatcgGATACGCGAGCGAACGTGA–3′	PCR amplification of the origin of replication (ori) and ampicillin resistance gene from pBR322 plasmid for subcloning (2763 bp)
PBR-R	5′–ACTACTTCACAACTATAATTTTGCTACTGTTGGTACTTTCAGGTTGCTGACATCAGATAATTCTTAGACGTCAGGTGGCAC–3′
Zeo-F	5′–ATGCATCCCAGACACTCAGACAGCCATCAGTCACTTGCCTGACACCGGTACCgcggccgcCAGACATGATAAGATACATTGATG–3′	PCR amplification of zeocin resistance gene from pBudCE4.1 plasmid (786 bp)
Zeo-R	5′–TAGACTTGGGCTGGTCACTCCCGACAGGCAGGGATGCCAGGGCCGGCTGCgcggccgcAGTGAGGAGGCTTTTTTGG–3′
ghLZ-F	5′–AATgcggccgcATGAAGGCTCTCATTGTTCTG–3′	PCR amplification of human lysozyme gene (4.8 kb) with two NotI restriction sites
ghLZ-R	5′–AATgcggccgcTTACACTCCACAACCTTGAAC –3′
mWAP- -atg-F	5′–AC CCTTGGCACAGTATGG–3′	The PCR product is 932 bp+ gene length (WAP is 3.0 kb, Zeo is 1.0 kb, and hLZ is 5.4 kb
mWAP-taa-R	5′–ATGGAGTTTGGCTGTA GCTC–3′
P1-F	5′–GATCCACAGGACGGGTGT–3′	PCR detection of transgenic founders (538 bp)
P1-R	5′–CTCCAGCCCACTATTTAGACA–3′	PCR detection of transgenic founders (538 bp)
P2-F	5′–CCGAGTGAATAAATTAGACA–3′	PCR detection of transgenic founders (568 bp)
P2-R	5′–ACGGAAATGTTGAATACTCAT–3′	PCR detection of transgenic founders (568 bp)
hLZ-F	5′–TTATACACACGGCTTTAC–3′	Primers for PCR detection and DIG-labeled probe synthesis (637 bp)
hLZ-R	5′–CAGCATCAGCGATGTTATCT–3′
Exon1-2-F	5′–ATCAGCCTAGCAAACTGGAT–3′	RT-PCR for hLZ (322 bp)
Exon4-R	5′–CTCCACAACCTTGAACATAC–3′	RT-PCR for hLZ (322 bp)
GAPDH-F	5′–AGGCCGGTGCTGAGTATGTC–3′	RT-PCR for GAPDH control (530 bp)
GAPDH-R	5′–TGCCTGCTTCACCACCTTCT–3′	RT-PCR for GAPDH control (530 bp)
hLZ-CP-F	5′–TGCTACCAGGGCTGGAGAAT–3′	Real-time PCR for hLZ (140 bp)
hLZ-CP-R	5′–AGCTCCTTCGCCTCCTACCA–3′	Real-time PCR for hLZ (140 bp)
Fabpi110-F	5′–TGTTCAGAGCCAGGAAATCCATA–3′	Real-time PCR for mouse Fabpi gene (110 bp) as control
Fabpi110-R	5′–CATAGGTGTCTCTTTCTTT GGTGTGT–3′	Real-time PCR for mouse Fabpi gene (110 bp) as control

Tab.1

Fig.1

Fig.2

Tab.2

Fig.3

Fig.4

1	Bertolini L R, Meade H, Lazzarotto C R, Martins L T, Tavares K C, Bertolini M, Murray J D. The transgenic animal platform for biopharmaceutical production. Transgenic Research, 2016, 25(3): 329–343 https://doi.org/10.1007/s11248-016-9933-9 pmid: 26820414
2	Romagnolo D, DiAugustine R P. The mammary gland: protein factory of the future. Environmental Health Perspectives, 1994, 102(8): 644–646 https://doi.org/10.1289/ehp.94102644 pmid: 7895703
3	Houdebine L M. Production of pharmaceutical proteins by transgenic animals. Comparative Immunology, Microbiology and Infectious Diseases, 2009, 32(2): 107–121 https://doi.org/10.1016/j.cimid.2007.11.005 pmid: 18243312
4	Babinet C. Transgenic mice: an irreplaceable tool for the study of mammalian development and biology. Journal of the American Society of Nephrology, 2000, 11(S16): S88–S94 pmid: 11065337
5	Monzani P S, Adona P R, Ohashi O M, Meirelles F V, Wheeler M B. Transgenic bovine as bioreactors: challenges and perspectives. Bioengineered, 2016, 7(3): 123–131 https://doi.org/10.1080/21655979.2016.1171429 pmid: 27166649
6	Li G, Shi W, Chen G, Chen H, Jiao H, Yan H, Ji M, Sun H. Construction and in vivo evaluation of a mammary gland-specific expression vector for human lysozyme. Plasmid, 2014, 76: 47–53 https://doi.org/10.1016/j.plasmid.2014.09.004 pmid: 25280784
7	Yu Z, Meng Q, Yu H, Fan B, Yu S, Fei J, Wang L, Dai Y, Li N. Expression and bioactivity of recombinant human lysozyme in the milk of transgenic mice. Journal of Dairy Science, 2006, 89(8): 2911–2918 https://doi.org/10.3168/jds.S0022-0302(06)72563-2 pmid: 16840606
8	Giraldo P, Montoliu L. Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Research, 2001, 10(2): 83–103 https://doi.org/10.1023/A:1008918913249 pmid: 11305364
9	Yang P, Wang J, Gong G, Sun X, Zhang R, Du Z, Liu Y, Li R, Ding F, Tang B, Dai Y, Li N. Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin. PLoS One, 2008, 3(10): e3453 https://doi.org/10.1371/journal.pone.0003453 pmid: 18941633
10	Rival-Gervier S, Viglietta C, Maeder C, Attal J, Houdebine L M. Position-independent and tissue-specific expression of porcine whey acidic protein gene from a bacterial artificial chromosome in transgenic mice. Molecular Reproduction and Development, 2002, 63(2): 161–167 https://doi.org/10.1002/mrd.90007 pmid: 12203825
11	Zhang Y, Muyrers J P, Testa G, Stewart A F. DNA cloning by homologous recombination in Escherichia coli. Nature Biotech-nology, 2000, 18(12): 1314–1317 https://doi.org/10.1038/82449 pmid: 11101815
12	Sharan S K, Thomason L C, Kuznetsov S G, Court D L. Recombineering: a homologous recombination-based method of genetic engineering. Nature Protocols, 2009, 4(2): 206–223 https://doi.org/10.1038/nprot.2008.227 pmid: 19180090
13	Liu S, Li X, Lu D, Shang S, Wang M, Zheng M, Zhang R, Tang B, Li Q, Dai Y, Li N. High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC. Transgenic Research, 2012, 21(2): 407–414 https://doi.org/10.1007/s11248-011-9536-4 pmid: 21805108
14	Zhang R, Guo C, Sui S, Yu T, Wang J, Li N. Comprehensive assessment of milk composition in transgenic cloned cattle. PLoS One, 2012, 7(11): e49697 https://doi.org/10.1371/journal.pone.0049697 pmid: 23185411
15	Hogan B, Constantini F, Lacy E. Manipulating the mouse embryo. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986
16	Yu H, Chen J, Liu S, Zhang A, Xu X, Wang X, Lu P, Cheng G. Large-scale production of functional human lysozyme in transgenic cloned goats. Journal of Biotechnology, 2013, 168(4): 676–683 https://doi.org/10.1016/j.jbiotec.2013.10.023 pmid: 24432381
17	Tong J, Wei H, Liu X, Hu W, Bi M, Wang Y, Li Q, Li N. Production of recombinant human lysozyme in the milk of transgenic pigs. Transgenic Research, 2011, 20(2): 417–419 https://doi.org/10.1007/s11248-010-9409-2 pmid: 20549346
18	Lu D, Li Q, Wu Z, Shang S, Liu S, Wen X, Li Z, Wu F, Li N. High-level recombinant human lysozyme expressed in milk of transgenic pigs can inhibit the growth of Escherichia coli in the duodenum and influence intestinal morphology of sucking pigs. PLoS One, 2014, 9(2): e89130 https://doi.org/10.1371/journal.pone.0089130 pmid: 24586544
19	Lu D, Liu S, Shang S, Wu F, Wen X, Li Z, Li Y, Hu X, Zhao Y, Li Q, Li N. Production of transgenic-cloned pigs expressing large quantities of recombinant human lysozyme in milk. PLoS One, 2015, 10(5): e0123551 https://doi.org/10.1371/journal.pone.0123551 pmid: 25955256
20	Lu D, Liu S, Ding F, Wang H, Li J, Li L, Dai Y, Li N. Large-scale production of functional human lysozyme from marker-free transgenic cloned cows. Scientific Reports, 2016, 6(1): 22947 https://doi.org/10.1038/srep22947 pmid: 26961596
21	Jung C J, Ménoret S, Brusselle L, Tesson L, Usal C, Chenouard V, Remy S, Ouisse L H, Poirier N, Vanhove B, de Jong P J, Anegon I. Comparative analysis of piggyBac, CRISPR/Cas9 and TALEN mediated BAC transgenesis in the zygote for the generation of humanized SIRPA rats. Scientific Reports, 2016, 6(1): 31455 https://doi.org/10.1038/srep31455 pmid: 27530248
22	Pittius C W, Hennighausen L, Lee E, Westphal H, Nicols E, Vitale J, Gordon K. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice. Proceedings of the National Academy of Sciences of the United States of America, 1988, 85(16): 5874–5878 https://doi.org/10.1073/pnas.85.16.5874 pmid: 2842753
23	Wall R J, Pursel V G, Shamay A, McKnight R A, Pittius C W, Hennighausen L. High-level synthesis of a heterologous milk protein in the mammary glands of transgenic swine. Proceedings of the National Academy of Sciences of the United States of America, 1991, 88(5): 1696–1700 https://doi.org/10.1073/pnas.88.5.1696 pmid: 1705703
24	Shi G, Chen H, Wu X, Zhou Y, Liu Z, Zheng T, Huang P. A mWAP-hLF hybrid gene locus gave extremely high level expression of human lactoferrin in the milk of transgenic mice. Transgenic Research, 2009, 18(4): 573–582 https://doi.org/10.1007/s11248-009-9248-1 pmid: 19219636
25	Wu X, Lin Y, Xiong F, Zhou Y, Yu F, Deng J, Huang P, Chen H. The extremely high level expression of human serum albumin in the milk of transgenic mice. Transgenic Research, 2012, 21(6): 1359–1366 https://doi.org/10.1007/s11248-012-9612-4 pmid: 22447034
26	Wu X, Lin Y, Xi Y, Shao Z, Zhou Y, Liu F, Chen H. The development of transgenic mice for the expression of large amounts of human lysozyme in milk. Biotechnology Letters, 2014, 36(6): 1197–1202 https://doi.org/10.1007/s10529-014-1476-7 pmid: 24563307
27	Clark A J, Bissinger P, Bullock D W, Damak S, Wallace R, Whitelaw C B, Yull F. Chromosomal position effects and the modulation of transgene expression. Reproduction, Fertility, and Development, 1994, 6(5): 589–598 https://doi.org/10.1071/RD9940589 pmid: 7569038

Viewed

Full text

Abstract

Cited

Shared

Discussed