Please wait a minute...
Frontiers of Environmental Science & Engineering

ISSN 2095-2201

ISSN 2095-221X(Online)

CN 10-1013/X

邮发代号 80-973

2018 Impact Factor: 3.883

Frontiers of Environmental Science & Engineering  2020, Vol. 14 Issue (1): 14   https://doi.org/10.1007/s11783-019-1193-5
  本期目录
A newly defined dioxygenase system from Mycobacterium vanbaalenii PYR-1 endowed with an enhanced activity of dihydroxylation of high-molecular-weight polyaromatic hydrocarbons
Yiquan Wu1,2, Ying Xu1,2(), Ningyi Zhou1,2
1. State Key Laboratory of Microbial Metabolism, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China
2. Joint International Research Laboratory of Metabolic & Developmental Sciences, Shanghai Jiao Tong University, Shanghai 200240, China
 全文: PDF(866 KB)   HTML
Abstract

Mycobacterium vanbaalenii PYR-1 utilizes PAHs at different rates.

• Both NidA3B3 and FNidA3B3 catalyze high-molecular-weight PAHs dihydroxylation.

• NidA3B3 shows an enhanced activity with an endogenous electron transport chain.

• FNidA3B3 has an enhanced activity by 50% approximately compared with NidA3B3.

• FNidA3B3/NidA3B3 and NidAB in the same strain come from different ancestors.

NidA3B3 is a terminal dioxygenase whose favorable substrates are high-molecular-weight polyaromatic hydrocarbons (PAHs) from Mycobacterium vanbaalenii PYR-1, a powerful PAHs degradation strain. NidA3B3 was reported to incorporate a dioxygen into the benzene ring of PAHs when equipped with an exogenous electron transport chain components PhdCD from Nocardioides sp. strain KP7 by biotransformation, but this enzyme system was not particularly efficient. In this study, strain PYR-1 was confirmed to utilize four different PAHs at different growth rates. When PhtAcAd, an endogenous electron transport chain of a phthalate dioxygenase system, was substituted for PhdCD to couple with NidA3B3, the specific activity to convert phenanthrene by strain BL21(DE3) [pNidA3B3-PhAcAd] was 0.15±0.03 U/mg, but the specific activity of strain BL21(DE3) [pNidA3B3-PhdCD] was only 0.025±0.006 U/mg. In addition, FNidA3, encoded by a newly defined ORF, has a prolonged 19-amino acid sequence at the N-terminal compared with NidA3. FNidA3B3 increased the activity by 50% approximately than NidA3B3 when using PhtAcAd. Components of the electron transport chain PhtAc and PhtAd were purified and characterized. The Km, kcat, kcat/Km values of the PhtAd were 123±26.9 M, 503±49.9 min1, 4.1 M1·min1, respectively. And the Km, kcat, kcat/Km values of the ferredoxin PhtAc were 52.5±9.7 M, 3.8±0.19 min1 and 0.07 M1·min1, respectively. Basing on the phylogenetic analysis, NidA3/FNidA3 were far from its isoenzyme NidA from the same strain. Combining their primary differences of transcriptional pattern in vivo, it indicated that the functionally similar Rieske dioxygenases NidA3B3/FNidA3B3 and NidAB might originate from different ancestors.

Key wordsBiodegradation    polyaromatic hydrocarbons    biotransformation    ring-hydroxylating dioxygenase system
收稿日期: 2019-08-20      出版日期: 2019-11-27
Corresponding Author(s): Ying Xu   
 引用本文:   
. [J]. Frontiers of Environmental Science & Engineering, 2020, 14(1): 14.
Yiquan Wu, Ying Xu, Ningyi Zhou. A newly defined dioxygenase system from Mycobacterium vanbaalenii PYR-1 endowed with an enhanced activity of dihydroxylation of high-molecular-weight polyaromatic hydrocarbons. Front. Environ. Sci. Eng., 2020, 14(1): 14.
 链接本文:  
https://academic.hep.com.cn/fese/CN/10.1007/s11783-019-1193-5
https://academic.hep.com.cn/fese/CN/Y2020/V14/I1/14
Fig.1  
Strains /Plasmids Characteristics Source
Strains
Mycobacterium vanbaalenii PYR-1 Wild type; PAHs degradation bacterium Leibniz-Institut DSMZ (German)
E.coli BL21 (DE3) FompT hsdSB (RbmB) gal (c I 857 ind1 Sam7 nin5 lacUV5 T7gene1) dcm (DE3) Novagen
E.coli T1 F??80lacZ?M15 (lacZYA-argF)U169 recA1 endA1 hsdR17(rk?, mk+) phoA supE44 l-thi-1 gyrA96 relA1 tonA Novagen
Plasmids
pETDuet-1 Ampr, co-expression vector Novagen
pFNidA3B3 fnidA3B3 cloned into pETDuet-1 This study
pNidA3B3 nidA3B3 cloned into pETDuet-1 This study
pFNidA3B3-PhtAcAd fnidA3B3 and phtAcAd cloned into pETDuet-1 This study
pNidA3B3-PhtAcAd nidA3B3 and phtAcAd cloned into pETDuet-1 This study
pNidA3B3-PhdCD nidA3B3 and phdCD cloned into pETDuet-1 This study
pPhtAc(His) phtAc cloned into pETDuet-1 with His tag This study
pPhtAd(His) phtAd cloned into pETDuet-1 with His tag This study
Tab.1  
Primers Sequencesa)
FnidA3 (Nco I)-F TAAGAAGGAGATATACCATGGGCATGAGTGCTCACGTTC
nidB3 (BamH I)-R GCCGAGCTCGAATTCGGATCCTTAGATCCAGAATGACAG
nidA3 (Nco I)-F TAAGAAGGAGATATACCATGGGCATGGCGCCTGATGCGA
phtAc (Nde I)-F TAAGAAGGAGATATACATATGATGGGCGGAGTTATAAAG
phtAd (KpnI)-R TTTACCAGACTCGAGGGTACCCTATGGTGATCGCGTTGC
phtAc (BamH I)-F TCATCACCACAGCCAGGATCCGATGGGCGGAGTTATAAA
phtAc (Hind III)-R GCATTATGCGGCCGCAAGCTTTCATTCGTCTACGACTTC
phtAd (BamH I)-F TCATCACCACAGCCAGGATCCGATGACGTCGCGGGTCGT
phtAd (Hind III)-R GCATTATGCGGCCGCAAGCTTCTATGGTGATCGCGTTGC
pNidA3 (BamH I)-F TCATCACCACAGCCAGGATCCGATGAGTGCTCACGTTCT
Tab.2  
Fig.2  
Fig.3  
Electron transport chain Specific activitya)
(U/mg)
Relative activityb)
(%)
PhtAcAd 0.15±0.03 100
PhdCD 0.025±0.006 16.7±2.3
Tab.3  
Fig.4  
Fig.5  
Fig.6  
1 S M Barry, G L Challis (2013). Mechanism and catalytic diversity of Rieske non-heme iron-dependent oxygenases. ACS Catalysis, 3(10): 2362–2370
https://doi.org/10.1021/cs400087p pmid: 24244885
2 B Boldrin, A Tiehm, C Fritzsche (1993). Degradation of phenanthrene, fluorene, fluoranthene, and pyrene by a Mycobacterium sp. Applied and Environmental Microbiology, 59(6): 1927–1930
pmid: 8328808
3 C E Boström, P Gerde, A Hanberg, B Jernström, C Johansson, T Kyrklund, A Rannug, M Törnqvist, K Victorin, R Westerholm (2002). Cancer risk assessment, indicators, and guidelines for polycyclic aromatic hydrocarbons in the ambient air. Environmental Health Perspectives, 110(Suppl 3): 451–488
pmid: 12060843
4 J K Capyk, I D’Angelo, N C Strynadka, L D Eltis (2009). Characterization of 3-ketosteroid 9-hydroxylase, a Rieske oxygenase in the cholesterol degradation pathway of Mycobacterium tuberculosis. Journal of biological chemistry, 284(15): 9937–9946
https://doi.org/10.1074/jbc.M900719200 pmid: 19234303
5 A Cébron, M P Norini, T Beguiristain, C Leyval (2008). Real-Time PCR quantification of PAH-ring hydroxylating dioxygenase (PAH-RHDalpha) genes from Gram positive and Gram negative bacteria in soil and sediment samples. Journal of Microbiological Methods, 73(2): 148–159
https://doi.org/10.1016/j.mimet.2008.01.009 pmid: 18329116
6 D Dean-Ross, C E Cerniglia (1996). Degradation of pyrene by Mycobacterium flavescens. Applied Microbiology and Biotechnology, 46(3): 307–312
https://doi.org/10.1007/s002530050822 pmid: 8933844
7 J M DeBruyn, T J Mead, G S Sayler (2012). Horizontal transfer of PAH catabolism genes in Mycobacterium: evidence from comparative genomics and isolated pyrene-degrading bacteria. Environmental Science & Technology, 46(1): 99–106
https://doi.org/10.1021/es201607y pmid: 21899303
8 B D Ensley, D T Gibson (1983). Naphthalene dioxygenase: Purification and properties of a terminal oxygenase component. Journal of Bacteriology, 155(2): 505–511
pmid: 6874638
9 F Fischer, D Raimondi, A Aliverti, G Zanetti (2002). Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase. European Journal of Biochemistry, 269(12): 3005–3013
https://doi.org/10.1046/j.1432-1033.2002.02989.x pmid: 12071965
10 M A Heitkamp, W Franklin, C E Cerniglia (1988). Microbial metabolism of polycyclic aromatic hydrocarbons: Isolation and characterization of a pyrene-degrading bacterium. Applied and Environmental Microbiology, 54(10): 2549–2555
pmid: 3202633
11 A Karlsson, J V Parales, R E Parales, D T Gibson, H Eklund, S Ramaswamy (2003). Crystal structure of naphthalene dioxygenase: Side-on binding of dioxygen to iron. Science, 299(5609): 1039–1042
https://doi.org/10.1126/science.1078020 pmid: 12586937
12 A A Khan, R F Wang, W W Cao, D R Doerge, D Wennerstrom, C E Cerniglia (2001). Molecular cloning, nucleotide sequence, and expression of genes encoding a polycyclic aromatic ring dioxygenase from Mycobacterium sp. strain PYR-1. Applied and Environmental Microbiology, 67(8): 3577–3585
https://doi.org/10.1128/AEM.67.8.3577-3585.2001 pmid: 11472934
13 S J Kim, O Kweon, J P Freeman, R C Jones, M D Adjei, J W Jhoo, R D Edmondson, C E Cerniglia (2006). Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high-molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Applied and Environmental Microbiology, 72(2): 1045–1054
https://doi.org/10.1128/AEM.72.2.1045-1054.2006 pmid: 16461648
14 S J Kim, O Kweon, R C Jones, R D Edmondson, C E Cerniglia (2008). Genomic analysis of polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Biodegradation, 19(6): 859–881
https://doi.org/10.1007/s10532-008-9189-z pmid: 18421421
15 S J Kim, O Kweon, R C Jones, J P Freeman, R D Edmondson, C E Cerniglia (2007). Complete and integrated pyrene degradation pathway in Mycobacterium vanbaalenii PYR-1 based on systems biology. Journal of Bacteriology, 189(2): 464–472
https://doi.org/10.1128/JB.01310-06 pmid: 17085566
16 O Kweon, S J Kim, J P Freeman, J Song, S Baek, C E Cerniglia (2010). Substrate specificity and structural characteristics of the novel Rieske nonheme iron aromatic ring-hydroxylating oxygenases NidAB and NidA3B3 from Mycobacterium vanbaalenii PYR-1. mBio, 1(2): e00135-10
https://doi.org/10.1128/mBio.00135-10 pmid: 20714442
17 O Kweon, S J Kim, R D Holland, H Chen, D W Kim, Y Gao, L R Yu, S Baek, D H Baek, H Ahn, C E Cerniglia (2011). Polycyclic aromatic hydrocarbon metabolic network in Mycobacterium vanbaalenii PYR-1. Journal of Bacteriology, 193(17): 4326–4337
https://doi.org/10.1128/JB.00215-11 pmid: 21725022
18 O Kweon, S J Kim, R C Jones, J P Freeman, M D Adjei, R D Edmondson, C E Cerniglia (2007). A polyomic approach to elucidate the fluoranthene-degradative pathway in Mycobacterium vanbaalenii PYR-1. Journal of Bacteriology, 189(13): 4635–4647
https://doi.org/10.1128/JB.00128-07 pmid: 17449607
19 O Kweon, S J Kim, D W Kim, J M Kim, H L Kim, Y Ahn, J B Sutherland, C E Cerniglia (2014). Pleiotropic and epistatic behavior of a ring-hydroxylating oxygenase system in the polycyclic aromatic hydrocarbon metabolic network from Mycobacterium vanbaalenii PYR-1. Journal of Bacteriology, 196(19): 3503–3515
https://doi.org/10.1128/JB.01945-14 pmid: 25070740
20 A Lama, S Pawaria, A Bidon-Chanal, A Anand, J L Gelpí, S Arya, M Martí, D A Estrin, F J Luque, K L Dikshit (2009). Role of Pre-A motif in nitric oxide scavenging by truncated hemoglobin, HbN, of Mycobacterium tuberculosis. Journal of biological chemistry, 284(21): 14457–14468
https://doi.org/10.1074/jbc.M807436200 pmid: 19329431
21 K McLean, A Dunford, M Sabri, R Neeli, H Girvan, P Balding, D Leys, H Seward, K Marshall, A Munro (2006). CYP121, CYP51 and Associated Redox Systems inMycobacterium tuberculosis: Towards Deconvoluting Enzymology of P450 Systems in a Human Pathogen. London: Portland Press Limited
22 J D Moody, J P Freeman, D R Doerge, C E Cerniglia (2001). Degradation of phenanthrene and anthracene by cell suspensions of Mycobacterium sp. strain PYR-1. Applied and Environmental Microbiology, 67(4): 1476–1483
https://doi.org/10.1128/AEM.67.4.1476-1483.2001 pmid: 11282593
23 J D Moody, J P Freeman, P P Fu, C E Cerniglia (2004). Degradation of benzo[a]pyrene by Mycobacterium vanbaalenii PYR-1. Applied and Environmental Microbiology, 70(1): 340–345
https://doi.org/10.1128/AEM.70.1.340-345.2004 pmid: 14711661
24 A Saito, T Iwabuchi, S Harayama (2000). A novel phenanthrene dioxygenase from Nocardioides sp. Strain KP7: Expression in Escherichia coli. Journal of Bacteriology, 182(8): 2134–2141
https://doi.org/10.1128/JB.182.8.2134-2141.2000 pmid: 10735855
25 J Schneider, R Grosser, K Jayasimhulu, W Xue, D Warshawsky (1996). Degradation of pyrene, benz[a]anthracene, and benzo[a]pyrene by Mycobacterium sp. strain RJGII-135, isolated from a former coal gasification site. Applied and Environmental Microbiology, 62(1): 13–19
pmid: 8572690
26 C Siebold, K Flükiger, R Beutler, B Erni (2001). Carbohydrate transporters of the bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS). FEBS Letters, 504(3): 104–111
https://doi.org/10.1016/S0014-5793(01)02705-3 pmid: 11532441
27 R L Stingley, B Brezna, A A Khan, C E Cerniglia (2004). Novel organization of genes in a phthalate degradation operon of Mycobacterium vanbaalenii PYR-1. Microbiology, 150(11): 3749–3761
https://doi.org/10.1099/mic.0.27263-0 pmid: 15528661
28 E A Stone, G C Lough, J J Schauer, P Praveen, C Corrigan, V Ramanathan (2007). Understanding the origin of black carbon in the atmospheric brown cloud over the Indian Ocean. Journal of Geophysical Research: Atmospheres, 112(D22): D22S23, 1-10
https://doi.org/10.1029/2006JD008118
29 L Wang, Y Z Gao, H Zhao, Y Xu, N Y Zhou (2019). Biodegradation of 2-bromonitrobenzene by Pseudomonas stutzeri ZWLR2–1. International Biodeterioration & Biodegradation, 138: 87–91
https://doi.org/10.1016/j.ibiod.2018.12.008
30 M D Wolfe, J V Parales, D T Gibson, J D Lipscomb (2001). Single turnover chemistry and regulation of O2 activation by the oxygenase component of naphthalene 1,2-dioxygenase. Journal of biological chemistry, 276(3): 1945–1953
https://doi.org/10.1074/jbc.M007795200 pmid: 11056161
31 Y Xu, N Y Zhou (2017). Microbial remediation of aromatics-contaminated soil. Frontiers of Environmental Science & Engineering, 11(2): 1–9
https://doi.org/10.1007/s11783-017-0894-x
32 C L Yu, W Liu, D J Ferraro, E N Brown, J V Parales, S Ramaswamy, G J Zylstra, D T Gibson, R E Parales (2007). Purification, characterization, and crystallization of the components of a biphenyl dioxygenase system from Sphingobium yanoikuyae B1. Journal of Industrial Microbiology & Biotechnology, 34(4): 311–324
https://doi.org/10.1007/s10295-006-0199-8 pmid: 17211635
33 Y Zhang, S Tao, H Shen, J Ma (2009). Inhalation exposure to ambient polycyclic aromatic hydrocarbons and lung cancer risk of Chinese population. Proceedings of the National Academy of Sciences of the United States of America, 106(50): 21063–21067
https://doi.org/10.1073/pnas.0905756106 pmid: 19995969
34 H W Zhou, C L Guo, Y S Wong, N F Y Tam (2006). Genetic diversity of dioxygenase genes in polycyclic aromatic hydrocarbon-degrading bacteria isolated from mangrove sediments. FEMS Microbiology Letters, 262(2): 148–157
https://doi.org/10.1111/j.1574-6968.2006.00379.x pmid: 16923069
35 N Y Zhou, J Al-Dulayymi, M S Baird, P A Williams (2002). Salicylate 5-hydroxylase from Ralstonia sp. strain U2: A monooxygenase with close relationships to and shared electron transport proteins with naphthalene dioxygenase. Journal of Bacteriology, 184(6): 1547–1555
https://doi.org/10.1128/JB.184.6.1547-1555.2002 pmid: 11872705
36 G Zink, K E Lorber (1995). Mass spectral identification of metabolites formed by microbial degradation of polycyclic aromatic hydrocarbons (PAH). Chemosphere, 31(9): 4077–4084
https://doi.org/10.1016/0045-6535(95)80009-A pmid: 8535829
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed