Please wait a minute...
Frontiers of Materials Science

ISSN 2095-025X

ISSN 2095-0268(Online)

CN 11-5985/TB

邮发代号 80-974

2019 Impact Factor: 1.747

Frontiers of Materials Science  2022, Vol. 16 Issue (4): 220617   https://doi.org/10.1007/s11706-022-0617-5
  本期目录
Regulation effect of osteoblasts towards osteocytes by silk fibroin encapsulation
Dandan LUO1,2,3, Rui ZHANG1,2, Shibo WANG1,2, M. Zubair IQBAL1,2, Ruibo ZHAO1,2(), Xiangdong KONG1,2
1. Institute of Smart Biomedical Materials, School of Materials Science and Engineering, Zhejiang Sci-Tech University, Hangzhou 310018, China
2. Zhejiang-Mauritius Joint Research Center for Biomaterials and Tissue Engineering, Zhejiang Sci-Tech University, Hangzhou 310018, China
3. School of Textile Science and Engineering, Zhejiang Sci-Tech University, Hangzhou 310018, China
 全文: PDF(24550 KB)   HTML
Abstract

Herein, the rational design micromilieus involved silk fibroin (SF)-based materials have been used to encapsulate the osteoblasts, forming an extracellular coated shell on the cells, which exhibited the high potential to shift the regulation of osteoblasts to osteocytes by encapsulation cues. SF coating treated cells showed a change in cell morphology from osteoblasts-like to osteocytes-like shape compared with untreated ones. Moreover, the expression of alkaline phosphatase (ALP), collagen I (Col I) and osteocalcin (OCN) further indicated a potential approach for inducing osteoblasts regulation, which typically accelerates calcium deposition and cell calcification, presenting a key role for the SF encapsulation in controlling osteoblasts behavior. This discovery showed that SF-based cell encapsulation could be used for osteoblasts behavior regulation, which offers a great potential to modulate mammalian cells’ phenotype involving alternating surrounding cues.

Key wordscell encapsulation    silk fibroin    osteoblasts modulation    cell differentiation    cell calcification
收稿日期: 2022-06-01      出版日期: 2022-10-19
Corresponding Author(s): Ruibo ZHAO   
 引用本文:   
. [J]. Frontiers of Materials Science, 2022, 16(4): 220617.
Dandan LUO, Rui ZHANG, Shibo WANG, M. Zubair IQBAL, Ruibo ZHAO, Xiangdong KONG. Regulation effect of osteoblasts towards osteocytes by silk fibroin encapsulation. Front. Mater. Sci., 2022, 16(4): 220617.
 链接本文:  
https://academic.hep.com.cn/foms/CN/10.1007/s11706-022-0617-5
https://academic.hep.com.cn/foms/CN/Y2022/V16/I4/220617
GeneGenbank accessionPrimer sequences (5' to 3')
Mouse GAPDHGU214026.1GAAGGTCGGTGTGAACGGATTTG
CATGTAGACCATGTAGTTGAGGTCA
Mouse ALPNM_007431.2ACCTGACTGACCCTTCGCTCT
CAATCCTGCCTCCTTCCACCA
Mouse Col INM_007743.2CCTTCTGGACCCGTTGGCAAAGAT
GGCTACCCTGAGAACCACGAACA
Mouse OCNNM_001032298.2CGCTCTGTCTCTCTGACCTCACA
CCTCCTGCTTGGACATGAAGGCTTT
Tab.1  
Fig.1  
Fig.2  
Fig.3  
Fig.4  
Fig.5  
Fig.6  
Fig.7  
1 W, Youn J Y, Kim J, Park et al.. Single-cell nanoencapsulation: from passive to active shells.Advanced Materials, 2020, 32(35): 1907001
https://doi.org/10.1002/adma.201907001
2 C C Perry . Silicification: the processes by which organisms capture and mineralize silica.Reviews in Mineralogy and Geochemistry, 2003, 54(1): 291–327
https://doi.org/10.2113/0540291
3 M, Hildebrand S J L Lerch . Diatom silica biomineralization: parallel development of approaches and understanding.Seminars in Cell & Developmental Biology, 2015, 46: 27–35
https://doi.org/10.1016/j.semcdb.2015.06.007
4 M A, Abdelhamid S P Pack . Biomimetic and bioinspired silicifications: recent advances for biomaterial design and applications.Acta Biomaterialia, 2021, 120: 38–56
https://doi.org/10.1016/j.actbio.2020.05.017
5 S, Yao B, Jin Z, Liu et al.. Biomineralization: from material tactics to biological strategy.Advanced Materials, 2017, 29(14): 1605903
https://doi.org/10.1002/adma.201605903
6 Z, Liu X, Xu R Tang . Improvement of biological organisms using functional material shells.Advanced Functional Materials, 2016, 26(12): 1862–1880
https://doi.org/10.1002/adfm.201504480
7 B, Wang P, Liu W, Jiang et al.. Yeast cells with an artificial mineral shell: protection and modification of living cells by biomimetic mineralization.Angewandte Chemie International Edition, 2008, 47: 3560–3564
https://doi.org/10.1002/anie.200704718
8 G, Wang L, Wang P, Liu et al.. Extracellular silica nanocoat confers thermotolerance on individual cells: a case study of material-based functionalization of living cells.ChemBioChem, 2010, 11(17): 2368–2373
https://doi.org/10.1002/cbic.201000494
9 Y, Yang G, Wang G, Zhu et al.. The effect of amorphous calcium phosphate on protein protection against thermal denaturation.Chemical Communications, 2015, 51(41): 8705–8707
https://doi.org/10.1039/C5CC01420D
10 D, Zhong Y, Wang F, Xie et al.. A biomineralized Prussian blue nanotherapeutic for enhanced cancer photothermal therapy.Journal of Materials Chemistry B, 2022, 10(25): 4889–4896
https://doi.org/10.1039/D2TB00775D
11 H, Amani H, Arzaghi M, Bayandori et al.. Controlling cell behavior through the design of biomaterial surfaces: a focus on surface modification techniques.Advanced Materials Interfaces, 2019, 6(13): 1900572
https://doi.org/10.1002/admi.201900572
12 R, Zhao J, Cao X, Yang et al.. Inorganic materials based macrophages regulation for cancer therapy: basic concepts and recent advances.Biomaterials Science, 2021, 9(13): 4568–4590
https://doi.org/10.1039/D1BM00508A
13 R, Zhao X, Liu X, Yang et al.. Nanomaterial-based organelles protect normal cells against chemotherapy-induced cytotoxicity.Advanced Materials, 2018, 30(27): 1801304
https://doi.org/10.1002/adma.201801304
14 D, Luo S, Ruan A, Liu et al.. Laminin functionalized biomimetic apatite to regulate the adhesion and proliferation behaviors of neural stem cells.International Journal of Nanomedicine, 2018, 13: 6223–6233
https://doi.org/10.2147/IJN.S176596
15 W, Xiong X, Zhao G, Zhu et al.. Silicification-induced cell aggregation for the sustainable production of H2 under aerobic conditions.Angewandte Chemie International Edition, 2015, 54(41): 11961–11965
https://doi.org/10.1002/anie.201504634
16 W, Youn E H, Ko M H, Kim et al.. Cytoprotective encapsulation of individual jurkat T cells within durable TiO2 shells for T-cell therapy.Angewandte Chemie International Edition, 2017, 56(36): 10702–10706
https://doi.org/10.1002/anie.201703886
17 J, Lee J, Choi J H, Park et al.. Cytoprotective silica coating of individual mammalian cells through bioinspired silicification.Angewandte Chemie International Edition, 2014, 53(31): 8056–8059
https://doi.org/10.1002/anie.201402280
18 Y, Wang D, Zhong F, Xie et al.. Manganese phosphate-doxorubicin-based nanomedicines using mimetic mineralization for cancer chemotherapy.ACS Biomaterials Science & Engineering, 2022, 8(5): 1930–1941
https://doi.org/10.1021/acsbiomaterials.2c00011
19 D P, Bhattarai S, Shrestha B K, Shrestha et al.. A controlled surface geometry of polyaniline doped titania nanotubes biointerface for accelerating MC3T3-E1 cells growth in bone tissue engineering.Chemical Engineering Journal, 2018, 350: 57–68
https://doi.org/10.1016/j.cej.2018.05.162
20 N, Dirckx M C, Moorer T L, Clemens et al.. The role of osteoblasts in energy homeostasis.Nature Reviews Endocrinology, 2019, 15(11): 651–665
https://doi.org/10.1038/s41574-019-0246-y
21 D, Khare B, Basu A K Dubey . Electrical stimulation and piezoelectric biomaterials for bone tissue engineering applications.Biomaterials, 2020, 258: 120280
22 R P, Abuna F S, Oliveira H B, Lopes et al.. The Wnt/β-catenin signaling pathway is regulated by titanium with nanotopography to induce osteoblast differentiation.Colloids and Surfaces B: Biointerfaces, 2019, 184: 110513
https://doi.org/10.1016/j.colsurfb.2019.110513
23 S, Nadine S G, Patrício C R, Correia et al.. Dynamic microfactories co-encapsulating osteoblastic and adipose-derived stromal cells for the biofabrication of bone units.Biofabrication, 2019, 12(1): 015005
https://doi.org/10.1088/1758-5090/ab3e16
24 G, Cheng Z, Davoudi X, Xing et al.. Advanced silk fibroin biomaterials for cartilage regeneration.ACS Biomaterials Science & Engineering, 2018, 4(8): 2704–2715
https://doi.org/10.1021/acsbiomaterials.8b00150
25 M K, DeBari C I III, King T A, Altgold et al.. Silk fibroin as a green material.ACS Biomaterials Science & Engineering, 2021, 7(8): 3530–3544
https://doi.org/10.1021/acsbiomaterials.1c00493
26 B, Kundu R, Rajkhowa S C, Kundu et al.. Silk fibroin biomaterials for tissue regenerations.Advanced Drug Delivery Reviews, 2013, 65(4): 457–470
https://doi.org/10.1016/j.addr.2012.09.043
27 T, Asakura T, Tanaka R Tanaka . Advanced silk fibroin biomaterials and application to small-diameter silk vascular grafts.ACS Biomaterials Science & Engineering, 2019, 5(11): 5561–5577
https://doi.org/10.1021/acsbiomaterials.8b01482
28 Y, Zhang L, Lu Y, Chen et al.. Polydopamine modification of silk fibroin membranes significantly promotes their wound healing effect.Biomaterials Science, 2019, 7(12): 5232–5237
https://doi.org/10.1039/C9BM00974D
29 B, Wang H, Xu J, Li et al.. Degradable allyl Antheraea pernyi silk fibroin thermoresponsive hydrogels to support cell adhesion and growth.RSC Advances, 2021, 11(45): 28401–28409
https://doi.org/10.1039/D1RA04436B
30 J R, Mauney T, Nguyen K, Gillen et al.. Engineering adipose-like tissue in vitro and in vivo utilizing human bone marrow and adipose-derived mesenchymal stem cells with silk fibroin 3D scaffolds.Biomaterials, 2007, 28(35): 5280–5290
https://doi.org/10.1016/j.biomaterials.2007.08.017
31 M, Garcia-Fuentes A J, Meinel M, Hilbe et al.. Silk fibroin/hyaluronan scaffolds for human mesenchymal stem cell culture in tissue engineering.Biomaterials, 2009, 30(28): 5068–5076
https://doi.org/10.1016/j.biomaterials.2009.06.008
32 Y, Yan B, Cheng K, Chen et al.. Enhanced osteogenesis of bone marrow-derived mesenchymal stem cells by a functionalized silk fibroin hydrogel for bone defect repair.Advanced Healthcare Materials, 2019, 8(3): 1801043
https://doi.org/10.1002/adhm.201801043
33 D K, Kim S, Lee M, Kim et al.. Exosome-coated silk fibroin 3D-scaffold for inducing osteogenic differentiation of bone marrow derived mesenchymal stem cells.Chemical Engineering Journal, 2021, 406: 127080
https://doi.org/10.1016/j.cej.2020.127080
34 D, Luo C, Yao R, Zhang et al.. Silk fibroin/collagen blended membrane fabricated via a green papermaking method for potential guided bone regeneration application: in vitro and in vivo evaluation.ACS Biomaterials Science & Engineering, 2021, 7(12): 5788–5797
https://doi.org/10.1021/acsbiomaterials.1c01060
35 H, Kong R, Zhao Q, Zhang et al.. Biosilicified oncolytic adenovirus for cancer viral gene therapy.Biomaterials Science, 2020, 8(19): 5317–5328
https://doi.org/10.1039/D0BM00681E
36 D, Luo X, Xu M Z, Iqbal et al.. siRNA-loaded hydroxyapatite nanoparticles for KRAS gene silencing in anti-pancreatic cancer therapy.Pharmaceutics, 2021, 13(9): 1428
https://doi.org/10.3390/pharmaceutics13091428
37 M Z, Iqbal D, Luo O U, Akakuru et al.. Facile synthesis of biocompatible magnetic titania nanorods for T1-magnetic resonance imaging and enhanced phototherapy of cancers.Journal of Materials Chemistry B, 2021, 9(33): 6623–6633
https://doi.org/10.1039/D1TB01097B
38 R, Zhao B, Wang X, Yang et al.. A drug-free tumor therapy strategy: cancer-cell-targeting calcification.Angewandte Chemie International Edition, 2016, 55(17): 5225–5229
https://doi.org/10.1002/anie.201601364
39 J O, Buitrago K D, Patel A, El-Fiqi et al.. Silk fibroin/collagen protein hybrid cell-encapsulating hydrogels with tunable gelation and improved physical and biological properties.Acta Biomaterialia, 2018, 69: 218–233
https://doi.org/10.1016/j.actbio.2017.12.026
40 M, Farina J F, Alexander U, Thekkedath et al.. Cell encapsulation: overcoming barriers in cell transplantation in diabetes and beyond.Advanced Drug Delivery Reviews, 2019, 139: 92–115
https://doi.org/10.1016/j.addr.2018.04.018
41 L, Chang X, Li X, Tang et al.. Micro-patterned hydroxyapatite/silk fibroin coatings on Mg‒Zn‒Y‒Nd‒Zr alloys for better corrosion resistance and cell behavior guidance.Frontiers of Materials Science, 2020, 14(4): 413–425
https://doi.org/10.1007/s11706-020-0525-5
42 S J, Xu F Z, Cui X L, Yu et al.. Glioma cell line proliferation controlled by different chemical functional groups in vitro.Frontiers of Materials Science, 2013, 7(1): 69–75
https://doi.org/10.1007/s11706-013-0195-7
43 D W, Li F L, He J, He et al.. From 2D to 3D: the morphology, proliferation and differentiation of MC3T3-E1 on silk fibroin/chitosan matrices.Carbohydrate Polymers, 2017, 178: 69–77
https://doi.org/10.1016/j.carbpol.2017.09.035
44 K J, Chalut E K Paluch . The actin cortex: a bridge between cell shape and function.Developmental Cell, 2016, 38(6): 571–573
https://doi.org/10.1016/j.devcel.2016.09.011
45 R A, Marklein Surdo J L, Lo I H, Bellayr et al.. High content imaging of early morphological signatures predicts long term mineralization capacity of human mesenchymal stem cells upon osteogenic induction.Stem Cells, 2016, 34(4): 935–947
https://doi.org/10.1002/stem.2322
46 D, Jhala H, Rather R Vasita . Polycaprolactone–chitosan nanofibers influence cell morphology to induce early osteogenic differentiation.Biomaterials Science, 2016, 4(11): 1584–1595
https://doi.org/10.1039/C6BM00492J
47 A U, Khan R, Qu T, Fan et al.. A glance on the role of actin in osteogenic and adipogenic differentiation of mesenchymal stem cells.Stem Cell Research & Therapy, 2020, 11(1): 283
https://doi.org/10.1186/s13287-020-01789-2
48 A, Rutkovskiy K O, Stensløkken I J Vaage . Osteoblast differentiation at a glance.Medical Science Monitor Basic Research, 2016, 22: 95–106
https://doi.org/10.12659/MSMBR.901142
49 E G, Long M, Buluk M B, Gallagher et al.. Human mesenchymal stem cell morphology, migration, and differentiation on micro and nano-textured titanium.Bioactive Materials, 2019, 4: 249–255
https://doi.org/10.1016/j.bioactmat.2019.08.001
50 L, He G, Si J, Huang et al.. Mechanical regulation of stem-cell differentiation by the stretch-activated Piezo channel.Nature, 2018, 555(7694): 103–106
https://doi.org/10.1038/nature25744
51 R, Yan J, Li Q, Wu et al.. Trace element-augmented titanium implant with targeted angiogenesis and enhanced osseointegration in osteoporotic rats.Frontiers in Chemistry, 2022, 10: 839062
https://doi.org/10.3389/fchem.2022.839062
52 M, Li P, Xiong M, Mo et al.. Electrophoretic-deposited novel ternary silk fibroin/graphene oxide/hydroxyapatite nanocomposite coatings on titanium substrate for orthopedic applications.Frontiers of Materials Science, 2016, 10(3): 270–280
https://doi.org/10.1007/s11706-016-0347-7
53 C, Liu H, Zhai Z, Zhang et al.. Cells recognize and prefer bone-like hydroxyapatite: biochemical understanding of ultrathin mineral platelets in bone.ACS Applied Materials & Interfaces, 2016, 8(44): 29997–30004
https://doi.org/10.1021/acsami.6b10374
54 Y, Yu B, Sun C, Yi et al.. Stem cell homing-based tissue engineering using bioactive materials.Frontiers of Materials Science, 2017, 11(2): 93–105
https://doi.org/10.1007/s11706-017-0373-0
55 Y, Tang P, Rajendran V P, Veeraraghavan et al.. Osteogenic differentiation and mineralization potential of zinc oxide nanoparticles from Scutellaria baicalensis on human osteoblast-like MG-63 cells.Materials Science and Engineering C, 2021, 119: 111656
https://doi.org/10.1016/j.msec.2020.111656
56 M, Patel W G Koh . Composite hydrogel of methacrylated hyaluronic acid and fragmented polycaprolactone nanofiber for osteogenic differentiation of adipose-derived stem cells.Pharmaceutics, 2020, 12(9): 902
https://doi.org/10.3390/pharmaceutics12090902
57 Z G, Karaji F, Jahanmard A H, Mirzaei et al.. A multifunctional silk coating on additively manufactured porous titanium to prevent implant-associated infection and stimulate bone regeneration.Biomedical Materials, 2020, 15(6): 065016
https://doi.org/10.1088/1748-605X/aba40b
58 J, Melke S, Midha S, Ghosh et al.. Silk fibroin as biomaterial for bone tissue engineering.Acta Biomaterialia, 2016, 31: 1–16
https://doi.org/10.1016/j.actbio.2015.09.005
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed