Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Agricultural Science and Engineering

ISSN 2095-7505

ISSN 2095-977X(Online)

CN 10-1204/S

Postal Subscription Code 80-906

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Agr. Sci. Eng.    2015, Vol. 2 Issue (3) : 242-248    https://doi.org/10.15302/J-FASE-2015059
RESEARCH ARTICLE
Generation of CRISPR/Cas9-mediated lactoferrin-targeted mice by pronuclear injection of plasmid pX330
Mengxu GE1,Fei LIU2,Fei CHANG1,Zhaolin SUN1,Jing FEI1,Ying GUO1,Yunping DAI1,Zhengquan YU1,Yaofeng ZHAO1,Ning LI1,2,*(),Qingyong MENG1,*()
1. State Key Laboratory of Agrobiotechnology, College of Biological Science, China Agricultural University, Beijing 100193, China
2. College of Animal Science and Technology, Yunnan Agricultural University, Kunming 650201, China
 Download: PDF(592 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Lactoferrin is a member of the transferrin family of multifunctional iron binding glycoproteins. While numerous physiological functions have been described for lactoferrin, the mechanisms underlying these functions are not clear. To further study the functions and mechanisms of lactoferrin, we modified the lactoferrin promoter of mice using the CRISPR/Cas9 system to reduce or eliminate lactoferrin expression. Seven mice with lactoferrin promoter mutations were obtained with an efficiency of 24% (7/29) by injecting the plasmid pX330, expressing a small guide RNA and human codon-optimized SpCas9, into fertilized eggs of mice. Plasmid integration and off-targeting of pX330 were not detected. These results confirmed that pronuclear injection of a circular plasmid is a feasible and efficient method for targeted mutagenesis in mice.
Keywords lactoferrin      promoter      CRISPR/Cas9      plasmid pX330     
Corresponding Author(s): Ning LI,Qingyong MENG   
Just Accepted Date: 15 June 2015   Online First Date: 06 July 2015    Issue Date: 10 November 2015
 Cite this article:   
Mengxu GE,Fei LIU,Fei CHANG, et al. Generation of CRISPR/Cas9-mediated lactoferrin-targeted mice by pronuclear injection of plasmid pX330[J]. Front. Agr. Sci. Eng. , 2015, 2(3): 242-248.
 URL:  
https://academic.hep.com.cn/fase/EN/10.15302/J-FASE-2015059
https://academic.hep.com.cn/fase/EN/Y2015/V2/I3/242
ScoregRNA
92CCCTACACAGGCGCTGGTACAGG
88AGTACCCCCTACACAGGCGCTGG
82AGCGCCTGTGTAGGGGGTACTGG
Tab.1  Three target sites within the basic LF promoter sequences
Fig.1  Preparation of the CRISPR/Cas9 plasmids. (a) Schematic of sgRNAs targeting sites at critical regions of the LF promoter. The protospacer adjacent motif (PAM) sequence is labeled in blue and a 12 bp seed sequence is highlighted in red; (b) observed expression of red fluorescent protein (RFP) and green fluorescent protein (GFP), 24 h after co-transfection of pX330-sgRNA and 2Se-sgRNA, by fluorescence microscopy. (c) The percentage of RFP+GFP+ cells by flow cytometry 48 h after co-transfection is shown; (d) T7EN1 assay for Cas9-mediated cleavage in C2C12 cells and its densitometry analysis by Image J.
No.InjectedPregnancyNewbornMutationIndel mutation frequencyMutation type
123841133/11 (27%)Three mice were all mutated 40 bp upstream of the target locus
232551844/18 (22%)Three of four were mutated at the target site, and the other one was mutated at both the target site and 40 bp upstream of the target locus.
Tab.2  Generation of mutant mice via pX330 plasmid injection
Fig.2  Generation of LF gene promoter mutation mice via the CRISPR/Cas9 system. (a) T7EN1 assay for Cas9-mediated cleavage in newborn mice from the first microinjection. Four pregnant mice resulting from the first microinjection gave birth to 11 mice. WT is the genome of Kunming wild-type mice; (b) T7EN1 assay for Cas9-mediated cleavage in newborn mice from the second microinjection. 3′, 10′, 14′, and 17′ represent the genomes of the newborn mice from the second microinjection; (c) DNA sequences of the WT and four mutant alleles in seven mice. The target site is underlined, and the PAM sequence is labeled in green. -//- represents an omitted base, and 18 and 15 bp are omitted from left to right. The numbers of mutant mice are in brackets.
Site nameSequenceIndel mutation frequency (Mutant/Total)CoordinateStrand
Target siteCCCTACACAGGCGCTGGTACAGG/chr 9: 111019095–111019117−
OT1aCaTACtCAGGCtCTGGTACAGG0/7chr 19: 48087277– 48087299−
OT2CtgTACACAGGtGCTGGTAaTGG0/7chr 18: 35579256–35579278+
OT3tCCTgCACAGGCtCTGGTAtAGG0/7chr 2: 121955005–121955027−
OT4tCCTgCACAGGCtCTGGTAtAGG0/7chr X: 91332097–91332119+
OT5tCCTgCACAGGCtCTGGTAtAGG0/3chr X: 92015969–92015991−
OT6CCacACACAGGgaCTGGTACAGG0/3chr 4: 135896156–135896178+
OT7CaCTACACAGGaGCTtGTACTGG0/3chr 7: 107035334–107035356−
OT8CCCTgCgCtGGCcCTGGTACAGG0/3chr 3: 27673749–27673771−
OT9CCCcACACAaGCtCTGcTACTGG0/3chr 10: 111084383–111084405+
OT10CCCcAaACAGGaGCTGGTAgGGG0/3chr X: 134240517–134240539+
OT11CCCTttACAGtCcCTGGTACAGG0/3chr 1: 166363559–166363581−
OT12CCCTACAtAGatGCTGtTACAGG0/3chr 19: 48586214–48586236−
Tab.3  Off-target analysis in LF mutant mice
1 Sorensen  M, Sorensen  S. The proteins in whey. Compte rendu des Travaux du Laboratoire de Carlsberg Ser Chim, 1940, 23(7): 55–99
2 Groves  M L. The isolation of a red protein from milk. Journal of the American Chemical Society, 1960, 82(13): 3345–3350
https://doi.org/10.1021/ja01498a029
3 Johanson  B, Virtanen  A I, Tweit  R C, Dodson  R M. Isolation of an iron-containing red protein from human milk. Acta Chemica Scandinavica, 1960, 14(2): 510–512
https://doi.org/10.3891/acta.chem.scand.14-0510
4 Montreuil  J, Tonnelat  J, Mullet  S. Preparation and properties of lactosiderophilin (lactotransferrin) of human milk. Biochimica et Biophysica Acta, 1960, 45: 413–421
https://doi.org/10.1016/0006-3002(60)91478-5 pmid: 13772242
5 Actor  J K, Hwang  S A, Kruzel  M L. Lactoferrin as a natural immune modulator. Current Pharmaceutical Design, 2009, 15(17): 1956–1973
https://doi.org/10.2174/138161209788453202 pmid: 19519436
6 Ward  P P, Conneely  O M. Lactoferrin: role in iron homeostasis and host defense against microbial infection. Biometals, 2004, 17(3): 203–208
https://doi.org/10.1023/B:BIOM.0000027693.60932.26 pmid: 15222466
7 Blais  A, Malet  A, Mikogami  T, Martin-Rouas  C, Tomé  D. Oral bovine lactoferrin improves bone status of ovariectomized mice. American Journal of Physiology, Endocrinology and Metabolism, 2009, 296(6): E1281–E1288
https://doi.org/10.1152/ajpendo.90938.2008 pmid: 19336659
8 Malet  A, Bournaud  E, Lan  A, Mikogami  T, Tomé  D, Blais  A. Bovine lactoferrin improves bone status of ovariectomized mice via immune function modulation. Bone, 2011, 48(5): 1028–1035
https://doi.org/10.1016/j.bone.2011.02.002 pmid: 21303707
9 Mulder  A M, Connellan  P A, Oliver  C J, Morris  C A, Stevenson  L M. Bovine lactoferrin supplementation supports immune and antioxidant status in healthy human males. Nutrition Research, 2008, 28(9): 583–589
https://doi.org/10.1016/j.nutres.2008.05.007 pmid: 19083463
10 Wang  Y Z, Shan  T Z, Xu  Z R, Feng  J, Wang  Z Q. Effects of the lactoferrin (LF) on the growth performance, intestinal microflora and morphology of weanling pigs. Animal Feed Science and Technology, 2007, 135(3): 263–272
https://doi.org/10.1016/j.anifeedsci.2006.07.013
11 Velusamy  S K, Ganeshnarayan  K, Markowitz  K, Schreiner  H, Furgang  D, Fine  D H, Velliyagounder  K. Lactoferrin knockout mice demonstrates greater susceptibility to Aggregatibacter actinomycetemcomitans–induced periodontal disease. Journal of Periodontology, 2013, 84(11): 1690–1701
pmid: 23327622
12 van der Strate  B W, Beljaars  L, Molema  G, Harmsen  M C, Meijer  D K. Antiviral activities of lactoferrin. Antiviral Research, 2001, 52(3): 225–239
https://doi.org/10.1016/S0166-3542(01)00195-4 pmid: 11675140
13 Farnaud  S, Evans  R W. Lactoferrin—a multifunctional protein with antimicrobial properties. Molecular Immunology, 2003, 40(7): 395–405
https://doi.org/10.1016/S0161-5890(03)00152-4 pmid: 14568385
14 Yang  N, Strøm  M B, Mekonnen  S M, Svendsen  J S, Rekdal  O. The effects of shortening lactoferrin derived peptides against tumour cells, bacteria and normal human cells. Journal of Peptide Science, 2004, 10(1): 37–46
https://doi.org/10.1002/psc.470 pmid: 14959890
15 Garneau  J E, Dupuis  M È, Villion  M, Romero  D A, Barrangou  R, Boyaval  P, Fremaux  C, Horvath  P, Magadán  A H, Moineau  S. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature, 2010, 468(7320): 67–71
https://doi.org/10.1038/nature09523 pmid: 21048762
16 Gasiunas  G, Barrangou  R, Horvath  P, Siksnys  V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America, 2012, 109(39): E2579–E2586
https://doi.org/10.1073/pnas.1208507109 pmid: 22949671
17 Jinek  M, Chylinski  K, Fonfara  I, Hauer  M, Doudna  J A, Charpentier  E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012, 337(6096): 816–821
https://doi.org/10.1126/science.1225829 pmid: 22745249
18 Mussolino  C, Cathomen  T. RNA guides genome engineering. Nature Biotechnology, 2013, 31(3): 208–209
https://doi.org/10.1038/nbt.2527 pmid: 23471067
19 Cho  S W, Kim  S, Kim  J M, Kim  J S. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nature Biotechnology, 2013, 31(3): 230–232
https://doi.org/10.1038/nbt.2507 pmid: 23360966
20 Shen  B, Zhang  J, Wu  H, Wang  J, Ma  K, Li  Z, Zhang  X, Zhang  P, Huang  X. Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell Research, 2013, 23(5): 720–723
https://doi.org/10.1038/cr.2013.46 pmid: 23545779
21 Hwang  W Y, Fu  Y, Reyon  D, Maeder  M L, Tsai  S Q, Sander  J D, Peterson  R T, Yeh  J R, Joung  J K. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature Biotechnology, 2013, 31(3): 227–229
https://doi.org/10.1038/nbt.2501 pmid: 23360964
22 Li  W, Teng  F, Li  T, Zhou  Q. Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nature Biotechnology, 2013, 31(8): 684–686
https://doi.org/10.1038/nbt.2652 pmid: 23929337
23 Niu  Y, Shen  B, Cui  Y, Chen  Y, Wang  J, Wang  L, Kang  Y, Zhao  X, Si  W, Li  W, Xiang  A P, Zhou  J, Guo  X, Bi  Y, Si  C, Hu  B, Dong  G, Wang  H, Zhou  Z, Li  T, Tan  T, Pu  X, Wang  F, Ji  S, Zhou  Q, Huang  X, Ji  W, Sha  J. Generation of gene-modified cynomolgus monkey via Cas9/RNA-mediated gene targeting in one-cell embryos. Cell, 2014, 156(4): 836–843
https://doi.org/10.1016/j.cell.2014.01.027 pmid: 24486104
24 Han  H, Ma  Y, Wang  T, Lian  L, Tian  X, Hu  R, Deng  S, Li  K, Wang  F, Li  N, Liu  G, Zhao  Y, Lian  Z. One-step generation of myostatin gene knockout sheep via the CRISPR/Cas9 system. Frontiers of Agricultural Science and Engineering, 2014, 1(1): 2–5
https://doi.org/10.15302/J-FASE-2014007
25 Liu  Y H, Teng  C T. Characterization of estrogen-responsive mouse lactoferrin promoter. Journal of Biological Chemistry, 1991, 266(32): 21880–21885
pmid: 1939212
26 Ramakrishna  S, Cho  S W, Kim  S, Song  M, Gopalappa  R, Kim  J S, Kim  H. Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nuclease-induced mutations. Nature Communications, 2014, 5(3378): 3378
pmid: 24569644
27 Dejosez  M, Krumenacker  J S, Zitur  L J, Passeri  M, Chu  L F, Songyang  Z, Thomson  J A, Zwaka  T P. Ronin is essential for embryogenesis and the pluripotency of mouse embryonic stem cells. Cell, 2008, 133(7): 1162–1174
https://doi.org/10.1016/j.cell.2008.05.047 pmid: 18585351
28 Yang  H, Wang  H, Shivalila  C S, Cheng  A W, Shi  L, Jaenisch  R. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell, 2013, 154(6): 1370–1379
https://doi.org/10.1016/j.cell.2013.08.022 pmid: 23992847
29 Cong  L, Ran  F A, Cox  D, Lin  S, Barretto  R, Habib  N, Hsu  P D, Wu  X, Jiang  W, Marraffini  L A, Zhang  F. Multiplex genome engineering using CRISPR/Cas systems. Science, 2013, 339(6121): 819–823
https://doi.org/10.1126/science.1231143 pmid: 23287718
30 Mashiko  D, Fujihara  Y, Satouh  Y, Miyata  H, Isotani  A, Ikawa  M. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports, 2013, 3(3355): 3355
pmid: 24284873
31 Fu  Y, Sander  J D, Reyon  D, Cascio  V M, Joung  J K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 2014, 32(3): 279–284
https://doi.org/10.1038/nbt.2808 pmid: 24463574
32 Ran  F A, Hsu  P D, Lin  C Y, Gootenberg  J S, Konermann  S, Trevino  A E, Scott  D A, Inoue  A, Matoba  S, Zhang  Y, Zhang  F. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell, 2013, 154(6): 1380–1389
https://doi.org/10.1016/j.cell.2013.08.021 pmid: 23992846
33 Tsai  S Q, Wyvekens  N, Khayter  C, Foden  J A, Thapar  V, Reyon  D, Goodwin  M J, Aryee  M J, Joung  J K. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nature Biotechnology, 2014, 32(6): 569–576
https://doi.org/10.1038/nbt.2908 pmid: 24770325
34 Wang  H, Yang  H, Shivalila  C S, Dawlaty  M M, Cheng  A W, Zhang  F, Jaenisch  R. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell, 2013, 153(4): 910–918
https://doi.org/10.1016/j.cell.2013.04.025 pmid: 23643243
[1] FASE-15059-OF-GMX_suppl_1 Download
[2] FASE-15059-OF-GMX_suppl_2 Download
[1] Zachariah MCLEAN, Björn OBACK, Götz LAIBLE. Embryo-mediated genome editing for accelerated genetic improvement of livestock[J]. Front. Agr. Sci. Eng. , 2020, 7(2): 148-160.
[2] Dan LU,Shengzhe SHANG,Shen LIU,Ying WU,Fangfang WU,Tan TAN,Qiuyan LI,Yunping DAI,Xiaoxiang HU,Yaofeng ZHAO,Ning LI. Expression of recombinant human butyrylcholinesterase in the milk of transgenic mice[J]. Front. Agr. Sci. Eng. , 2014, 1(3): 179-184.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed