Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Agricultural Science and Engineering

ISSN 2095-7505

ISSN 2095-977X(Online)

CN 10-1204/S

Postal Subscription Code 80-906

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Agr. Sci. Eng.    2019, Vol. 6 Issue (1) : 66-72    https://doi.org/10.15302/J-FASE-2018229
RESEARCH ARTICLE
Construction of multiple shRNA vectors targeting PEDV and TGEV and production of transgenic SCNT porcine embryos in vitro
Jianwen CHEN1, Kaiyuan PAN1, Zhen CHEN1, Biao DING1, Dandan SONG1, Wenbin BAO2(), Yunhai ZHANG1()
1. Anhui Provincial Laboratory of Local Livestock and Poultry, Genetical Resource Conservation and Breeding, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China
2. College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
 Download: PDF(2105 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Porcine viral diarrhea is an acute and highly contagious enteric disease of pigs that causes huge economic losses worldwide. Porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV) are the main pathogens responsible for piglet viral diarrhea. However, currently there is no specific drug available for the effective treatment of viral diarrhea. Therefore, it is necessary to seek an effective method to diminish PEDV and TGEV infection rates. RNA interference has been applied successfully to inhibit the virus replication. It provides a potential strategy for breeding resistant pigs. In this study, four promoters and four short hairpin RNA (shRNA) vectors with LoxP sites at each end of the selectable marker genes were constructed to target PEDV and TGEV. These vectors were then transfected into porcine fetal fibroblasts, G418 resistant transfectants were confirmed by PCR and transgenic SCNT porcine blastocysts were obtained. These results have paved the way for future production of marker-free transgenic resistant to PEDV and TEGV pigs by SCNT.
Keywords piglet diarrhea      RNAi      PEDV      TGEV      transgenic resistance breeding     
Corresponding Author(s): Wenbin BAO,Yunhai ZHANG   
Just Accepted Date: 14 May 2018   Online First Date: 19 June 2018    Issue Date: 25 February 2019
 Cite this article:   
Jianwen CHEN,Kaiyuan PAN,Zhen CHEN, et al. Construction of multiple shRNA vectors targeting PEDV and TGEV and production of transgenic SCNT porcine embryos in vitro[J]. Front. Agr. Sci. Eng. , 2019, 6(1): 66-72.
 URL:  
https://academic.hep.com.cn/fase/EN/10.15302/J-FASE-2018229
https://academic.hep.com.cn/fase/EN/Y2019/V6/I1/66
shRNA name Oligo nucleotide sequence (5′–3′) Gene location
shRNA1 5'-CACCTGCAGTGATGTTTCTTGGATTCAAGACGTCCAAGAAACATCACTGCA TTTTTTG-3'
5'-AGCTC AAAAAATGCAGTGATGTTTCTTGGACGTCTTGAATCCAAGAAACATCACTGCA-3'		 Spike
shRNA 2 5'-TTTGCCGAGTTGAGACATATATC TTCAAGACGGATATATGTCTCAACTCGG TTTTTTG-3'
5'-AGCTC AAAAAACCGAGTTGAGACATATATCCGTCTTGAAGATATATGTCTCAACTCGG-3'		 ORF3
shRNA 3 5'-CCTCGTACTGGGATCGCACATATTTCAAGACGATATGTGCGATCCCAGTAC TTTTTTG-3'
5'- AGCTCAAAAAAGTACTGGGATCGCACATATCGTCTTGAAATATGTGCGATCCCAGTAC-3'		 Pol
shRNA 4 5'-TCCCGGCAAGAGCTCGTACAGTATTCAAGACGTACTGTACGAGCTCTTGCC TTTTTTG-3'
5'-AGCTC AAAAAAGGCAAGAGCTCGTACAGTACGTCTTGAATACTGTACGAGCTCTTGCC-3'		 Pol
Tab.1  shRNA sequences selected to design shRNA sequences for targeting PEDV and TGEV
Fig.1  Vector expressing four shRNAs targeting PEDV and TGEV driven by four different promoters (hU6, mU6, h7SK and hH1)
Fig.2  S gene of 15 PEDV strains homology tree analysis
PEDV Field strains Abbreviations S gene/nt S protein (aa) Accession number
CH-BJSY-2011-S BJSY 4149 1382 JQ638921.1
CH-FJND-1-2011-S FJND-1 4149 1382 JN543367
CH-FJND-2-2011-S FJND-2 4146 1381 JN315706.1
CH-FJND-3-2011-S FJND-3 4161 1386 JQ282909.1
CH-HBBD-2011-S HBBD 4170 1389 JQ638918
CH-HBQHD-2011-S HBQHD 4161 1386 JQ638922
HBMC-2012-S HBMC 4161 1386 JX163294.1
CH-JL-2011-S JL 4149 1382 JQ638924
CH-JLCC-2011-S JLCC 4161 1386 JQ638920
CH-JLGZL-2011-S JLGZL 4152 1383 JQ638923
CH-SDLY-2011-S SDLY 4161 1386 JQ638917
CH-SDQD-2011-S SDQD 4161 1386 JQ638919
HuN-S HuN 4161 1386 JQ517274.1
CV777-S CV777 4149 1382 JN599150.1
KH-S KH 4164 1387 AB548622.1
Tab.2  S gene of 15 PEDV strains analysis
Fig.3  The transgenic porcine fibroblast clones
Fig.4  Identification of transgenic porcine fibroblast clones by PCR. Lane 1, Marker; Lane 2, Transgenic porcine fibroblast; Lane 3, Non-transgenic porcine fibroblast.
Fig.5  Transgenic cloned embryos can be seen under a fluorescence microscope
Fig.6  Identification of transgenic porcine blastocyst by PCR. Lane 1, Marker; lane 2, Transgenic porcine embryo; lane 3, Non-transgenic porcine embryo.
1 E NWood. An apparently new syndrome of porcine epidemic diarrhoea. Veterinary Record, 1977, 100(12): 243–244
https://doi.org/10.1136/vr.100.12.243 pmid: 888300
2 JBi, S Zeng, SXiao, HChen, L Fang. Complete genome sequence of porcine epidemic diarrhea virus strain AJ1102 isolated from a suckling piglet with acute diarrhea in China. Journal of Virology, 2012, 86(19): 10910–10911
https://doi.org/10.1128/JVI.01919-12 pmid: 22966198
3 X MWang, B B Niu, H Yan, D SGao, XYang, L Chen, H TChang, JZhao, C Q Wang. Genetic properties of endemic Chinese porcine epidemic diarrhea virus strains isolated since 2010. Archives of Virology, 2013, 158(12): 2487–2494
https://doi.org/10.1007/s00705-013-1767-7 pmid: 23797760
4 JChen, X Liu, DShi, HShi, X Zhang, LFeng, YSong, Y Bi. Complete genome sequence of a porcine epidemic diarrhea virus variant. Journal of Virology, 2012, 86(6): 3408
https://doi.org/10.1128/JVI.07150-11 pmid: 22354946
5 RSun, R Cai, YChen, PLiang, DChen, C Song. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerging Infectious Diseases, 2012, 18(1): 161–163
https://doi.org/10.3201/eid1801.111259 pmid: 22261231
6 CChae, O Kim, CChoi, KMin, W S Cho, J Kim, J HTai. Prevalence of porcine epidemic diarrhoea virus and transmissible gastroenteritis virus infection in Korean pigs. Veterinary Record, 2000, 147(21): 606–608
https://doi.org/10.1136/vr.147.21.606 pmid: 11110482
7 XRen, J Glende, JYin, CSchwegmann-Wessels, GHerrler. Importance of cholesterol for infection of cells by transmissible gastroenteritis virus. Virus Research, 2008, 137(2): 220–224
https://doi.org/10.1016/j.virusres.2008.07.023 pmid: 18727942
8 JLyall, R M Irvine, A Sherman, T JMcKinley, ANúñez, APurdie, LOuttrim, I HBrown, GRolleston-Smith, HSang, L Tiley. Suppression of avian influenza transmission in genetically modified chickens. Science, 2011, 331(6014): 223–226
https://doi.org/10.1126/science.1198020 pmid: 21233391
9 APfeifer, S Eigenbrod, SAl-Khadra, AHofmann, GMitteregger, MMoser, UBertsch, HKretzschmar. Lentivector-mediated RNAi efficiently suppresses prion protein and prolongs survival of scrapie-infected mice. Journal of Clinical Investigation, 2006, 116(12): 3204–3210
https://doi.org/10.1172/JCI29236 pmid: 17143329
10 M CGolding, C R Long, M A Carmell, G J Hannon, M E Westhusin. Suppression of prion protein in livestock by RNA interference. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(14): 5285–5290
https://doi.org/10.1073/pnas.0600813103 pmid: 16567624
11 JRamsoondar, T Vaught, SBall, MMendicino, JMonahan, PJobst, AVance, JDuncan, KWells, DAyares. Production of transgenic pigs that express porcine endogenous retrovirus small interfering RNAs. Xenotransplantation, 2009, 16(3): 164–180 PMID:19566656
https://doi.org/10.1111/j.1399-3089.2009.00525.x
12 HChi, M Shinohara, TYokomine, MSato, S Takao, MYoshida, KMiyoshi. Successful suppression of endogenous a-1,3-galactosyltransferase expression by RNA interference in pig embryos generated in vitro. Journal of Reproduction and Development, 2012, 58(1): 69–76
https://doi.org/10.1262/jrd.10-165M pmid: 21997138
13 YBao, Y Guo, LZhang, ZZhao, N Li. Inhibition of porcine reproductive and respiratory syndrome virus replication by RNA interference in MARC-145 cells. Molecular Biology Reports, 2012, 39(3): 2515–2522
https://doi.org/10.1007/s11033-011-1003-z pmid: 21667252
14 JLuo, J Du, SGao, GZhang, JSun, G Cong, JShao, TLin, H Chang. Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin av subunit, the FMDV receptor, and against FMDV infection in PK-15 cells. Virology Journal, 2011, 8(1): 428
https://doi.org/10.1186/1743-422X-8-428 pmid: 21899738
15 DTang, H Zhu, JWu, HChen, Y Zhang, XZhao, XChen, W Du, DWang, XLin. Silencing myostatin gene by RNAi in sheep embryos. Journal of Biotechnology, 2012, 158(3): 69–74
https://doi.org/10.1016/j.jbiotec.2012.01.008 pmid: 22285957
16 SHu, W Ni, WSai, HZi, J Qiao, PWang, JSheng, CChen. Knockdown of myostatin expression by RNAi enhances muscle growth in transgenic sheep. PLoS One, 2013, 8(3): e58521
https://doi.org/10.1371/journal.pone.0058521 pmid: 23526994
17 SHu, J Qiao, QFu, CChen, W Ni, SWujiafu, SMa, H Zhang, JSheng, PWang, D Wang, JHuang, LCao, H Ouyang. Transgenic shRNA pigs reduce susceptibility to foot and mouth disease virus infection. eLife, 2015, 4: e06951
https://doi.org/10.7554/eLife.06951 pmid: 26090904
18 KWang, W Lu, JChen, SXie, H Shi, HHsu, WYu, K Xu, CBian, W BFischer, WSchwarz, LFeng, B Sun. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Letters, 2012, 586(4): 384–391
https://doi.org/10.1016/j.febslet.2012.01.005 pmid: 22245155
19 JZhou, X Hua, LCui, JZhu, D Miao, YZou, XHe, W Su. Effective inhibition of porcine transmissible gastroenteritis virus replication in ST cells by shRNAs targeting RNA-dependent RNA polymerase gene. Antiviral Research, 2007, 74(1): 36–42
https://doi.org/10.1016/j.antiviral.2006.12.007 pmid: 17287033
20 JZhou, F Huang, XHua, LCui, W Zhang, YShen, YYan, P Chen, DDing, JMou, Q Chen, DLan, ZYang. Inhibition of porcine transmissible gastroenteritis virus (TGEV) replication in mini-pigs by shRNA. Virus Research, 2010, 149(1): 51–55
https://doi.org/10.1016/j.virusres.2009.12.012 pmid: 20080134
21 E MWesterhout, MOoms, M Vink, A TDas, BBerkhout. HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome. Nucleic Acids Research, 2005, 33(2): 796–804
https://doi.org/10.1093/nar/gki220 pmid: 15687388
22 MKonishi, C H Wu, M Kaito, KHayashi, SWatanabe, YAdachi, G YWu. siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations. Journal of Viral Hepatitis, 2006, 13(11): 756–761
https://doi.org/10.1111/j.1365-2893.2006.00752.x pmid: 17052275
23 JChen, Y Zhang, YZhang, CWei, X Liu, NZhou, QJia, Y Li, XZhang, YZhang. Construction of multiple shRNAs expression vector that inhibits FUT1 gene expression and production of the transgenic SCNT embryos in vitro. Molecular Biology Reports, 2013, 40(3): 2243–2252
https://doi.org/10.1007/s11033-012-2287-3 pmid: 23203408
24 JChen, X Liu, DShi, HShi, X Zhang, CLi, YChi, L Feng. Detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in China. Viruses, 2013, 5(10): 2601–2613
https://doi.org/10.3390/v5102601 pmid: 24153062
25 Oter Brake, P Konstantinova, MCeylan, BBerkhout. Silencing of HIV-1 with RNA interference: a multiple shRNA approach. Molecular Therapy, 2006, 14(6): 883–892
https://doi.org/10.1016/j.ymthe.2006.07.007 pmid: 16959541
26 OBrake, K Hooft, Y PLiu, MCentlivre, KJasmijn von Eije, BBerkhout. Lentiviral vector design for multiple shRNA expression and durable HIV-1 inhibition. Molecular Therapy, 2008, 16(3): 557–564
https://doi.org/10.1038/sj.mt.6300382 pmid: 18180777
27 JJi, M Wernli, TKlimkait, PErb. Enhanced gene silencing by the application of multiple specific small interfering RNAs. FEBS Letters, 2003, 552(2-3): 247–252
https://doi.org/10.1016/S0014-5793(03)00893-7 pmid: 14527694
28 JLi, Y Dai, SLiu, HGuo, T Wang, HOuyang, CTu. In vitro inhibition of CSFV replication by multiple siRNA expression. Antiviral Research, 2011, 91(2): 209–216
https://doi.org/10.1016/j.antiviral.2011.06.005 pmid: 21699919
29 ZPenzes, J M Gonzalez, E Calvo, AIzeta, CSmerdou, AMéndez, C MSanchez, ISola, F Almazan, LEnjuanes. Complete genome sequence of transmissible gastroenteritis coronavirus PUR46-MAD clone and evolution of the purdue virus cluster. Virus Genes, 2001, 23(1): 105–118
https://doi.org/10.1023/A:1011147832586 pmid: 11556396
30 S JKim, J H Han, H M Kwon. Partial sequence of the spike glycoprotein gene of transmissible gastroenteritis viruses isolated in Korea. Veterinary Microbiology, 2003, 94(3): 195–206
https://doi.org/10.1016/S0378-1135(03)00101-9 pmid: 12814887
31 B JBosch, R van der Zee, C Ade Haan, P JRottier. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. Journal of Virology, 2003, 77(16): 8801–8811
https://doi.org/10.1128/JVI.77.16.8801-8811.2003 pmid: 12885899
32 SChang, J Bae, TKang, JKim, G H Chung, C W Lim, H Laude, MYang, Y SJang. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Molecules and Cells, 2002, 14(2): 295–299
pmid: 12442904
33 HLiu, M S Jan, C K Chou, P Chen, NKe. Is green fluorescent protein toxic to the living cells? Biochemical and Biophysical Research Communications, 1999, 260(3): 712–717
https://doi.org/10.1006/bbrc.1999.0954 pmid: 10403831
34 H EKrestel, A L Mihaljevic, D A Hoffman, A Schneider. Neuronal co-expression of EGFP and beta-galactosidase in mice causes neuropathology and premature death. Neurobiology of Disease, 2004, 17(2): 310–318
https://doi.org/10.1016/j.nbd.2004.05.012 pmid: 15474368
35 W YHuang, J Aramburu, P SDouglas, SIzumo. Transgenic expression of green fluorescence protein can cause dilated cardiomyopathy. Nature Medicine, 2000, 6(5): 482–483
https://doi.org/10.1038/74914 pmid: 10802676
36 D MDaigle, G A McKay, P R Thompson, G D Wright. Aminoglycoside antibiotic phosphotransferases are also serine protein kinases. Chemistry & Biology, 1999, 6(1): 11–18
https://doi.org/10.1016/S1074-5521(99)80016-7 pmid: 9889150
37 BMiki, A Abdeen, YManabe, PMacDonald. Selectable marker genes and unintended changes to the plant transcriptome. Plant Biotechnology Journal, 2009, 7(3): 211–218
https://doi.org/10.1111/j.1467-7652.2009.00400.x pmid: 19261135
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed