Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Chemical Science and Engineering

ISSN 2095-0179

ISSN 2095-0187(Online)

CN 11-5981/TQ

Postal Subscription Code 80-969

2018 Impact Factor: 2.809

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Chem. Sci. Eng.    2023, Vol. 17 Issue (2) : 156-166    https://doi.org/10.1007/s11705-022-2196-5
RESEARCH ARTICLE
Discovery of cryptolepine derivatives as novel promising agents against phytopathogenic bacteria
Ying-Hui He1,2, Qing-Ru Chu2, Shao-Yong Zhang1, Li-Rong Guo2, Yue Ma2, Bao-Qi Zhang2, Zhi-Jun Zhang2, Wen-Bin Zhao2, Yong-Mei Hu2, Chen-Jie Yang2, Sha-Sha Du2, Tian-Lin Wu2, Ying-Qian Liu1,2,3()
1. Key Laboratory of Vector Biology and Pathogen Control of Zhejiang Province, College of Life Science, Huzhou University, Huzhou 313000, China
2. School of Pharmacy, Lanzhou University, Lanzhou 730000, China
3. Laboratory of Grassland Agro-ecosystems, Lanzhou University, Lanzhou 730000, China
 Download: PDF(12223 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

To ensure the production of food crops, a series of cryptolepine derivatives were synthesised, after which their antibacterial activities and mechanism of action against three plant pathogens were investigated. Our bioassay results indicated that most of the target compounds displayed potent inhibitory effects against Xanthomonas oryzae (X. oryzae) and Xanthomonas axonopodis pv. citri (X. axonopodis pv. c.). Remarkably, compound 9 exhibited the best in vitro antibacterial activity against X. oryzae, with a minimum inhibitory concentration (MIC) value of 0.78 μg·mL–1. Compound 2 exhibited the best in vitro antibacterial activity against X. axonopodis pv. c., with an MIC value of 0.39 μg·mL–1. These activities were superior to those of copper quinolate (MIC = 6.25, 25 μg·mL–1) and thiodiazole copper (MIC = 100, 200 μg·mL–1) against X. oryzae and X. axonopodis pv. c. In vivo experiments demonstrated the promising applicability of compound 9 for the control of rice bacterial infections. Furthermore, compound 9 was selected as a candidate to conduct preliminary analyses of the antibacterial mechanisms of cryptolepine derivatives. Scanning electron microscopy and transmission electron microscopy observations, extracellular polysaccharide production, biofilm formation, transcriptomic, quantitative reverse transcription-polymerase chain reaction analyses, and molecular docking assays were performed. Collectively, our findings demonstrated that compound 9 might act via multifarious mechanisms to down-regulate virulence factors and cause cell death.

Keywords cryptolepine derivatives      phytopathogenic bacteria      antibacterial activity      mechanism of action     
Corresponding Author(s): Ying-Qian Liu   
About author:

Changjian Wang and Zhiying Yang contributed equally to this work.
Online First Date: 09 October 2022    Issue Date: 27 February 2023
 Cite this article:   
Ying-Hui He,Qing-Ru Chu,Shao-Yong Zhang, et al. Discovery of cryptolepine derivatives as novel promising agents against phytopathogenic bacteria[J]. Front. Chem. Sci. Eng., 2023, 17(2): 156-166.
 URL:  
https://academic.hep.com.cn/fcse/EN/10.1007/s11705-022-2196-5
https://academic.hep.com.cn/fcse/EN/Y2023/V17/I2/156
  Scheme1 Synthesis of target compounds 1–26.
Gene ID Gene description Relative function or pathway Primer sequences
GM000785 Type II/IV secretion system proteinSRP-dependent cotranslational protein targeting membrane TransportEstablishment of localizationLocalization F: GAGGTCAAGCAGGCGATGGAAGR: CGACTTCACCATGCGGAACAGG
GM000739 ATP synthase subunit C TransportEstablishment of localizationLocalization F: GGCTGGCAAGTTCCTGGAATCGR: GGCCTGCGGTGATGAACATACG
GM000272 Cellulase (glycosyl hydrolase family 5) Carbohydrate metabolic processHydrolase activity F: GTGTCCACGTTTACCGATGTR: CCGAAATATTGTTGGGCTCATTC
GM000002 DNA polymerase III beta subunit Hydrolase activityDNA replicationBiosynthetic processNucleic acid metabolic process F: CACAACCCAGAGCAAGAAGAR: ACAACGCATCGAGCAGATAG
GM000203 Spermine/spermidine synthase Arginine and proline metabolismGlutathione metabolismCysteine and methionine metabolism F: GTTCTACGAGAGCTGCTTCAAR: CCATTTCGGTGCGCATTTC
GM004404 DNA-binding domain of Proline dehydrogenaseProline dehydrogenaseAldehyde dehydrogenase family Arginine and proline metabolismAlanine, aspartate and glutamate metabolismBiosynthesis of secondary metabolites F: GATGTTCGCCACGCATAACR: ACTTCGGCATACAGGTCATC
GM003622 Catalase-related immune-responsiveCatalase Tryptophan metabolismGlyoxylate and dicarboxylate metabolismBiosynthesis of secondary metabolitesCarbon metabolism F: ACTGGATTTCGTGAGCTGTGR: CCGCATCCTTGCCGATATT
ftsZ Cell division protein Cell division F: GCTGCTGGACGATGTGAACCTGR: CGTCGAACTCGGACATGGTGAAG
gyrB DNA gyrase B – F: CGACATCGTGGCGAAAATCCR: CATGGTTTCCTGGTAGGCGT
Tab.1  Key DEGs and primer sequences used to perform qRT-PCR
Compounds R1 R2 R3 R4 MIC/(μg·mL–1)
X. oryzae X. axonopodis pv . c. P. atrosepticum
1 H H H H 1.56 0.78 100
2 H H H Cl 3.12 0.39 50
3 H H H OCH3 1.56 1.56 25
4 H H H CF3 3.12 3.12 50
5 H H H iPr 25 6.25 50
6 H H CH3 H 1.56 3.12 50
7 H H OCH3 H 12.5 3.12 50
8 H H Cl H >100 >100 >100
9 CH3 H H H 0.78 1.56 50
10 OCH3 H H H 1.56 1.56 25
11 F H H H 12.5 3.12 25
12 Cl H H H 3.12 0.78 6.25
13 Br H H H 1.56 0.78 12.5
14 H CH3 H H 1.56 3.12 50
15 H F H H 6.25 3.12 25
16 H Cl H H 1.56 1.56 12.5
17 H Br H H 12.5 1.56 25
18 F H H CH3 6.25 3.12 >100
19 Cl H H CH3 50 3.12 12.5
20 Br H H CH3 50 12.5 25
21 Cl H H OCH3 >100 12.5 100
22 F H H F 25 12.5 >100
23 Cl H H F 6.25 1.56 6.25
24 Br H H F 3.12 1.56 50
25 Cl H H Cl 3.12 0.78 6.25
26 Br H H Cl 50 3.12 100
CQ – – – – 6.25 25 >100
TC – – – – 100 200 200
Tab.2  In vitro antibacterial activities of compounds 1–26 against phytopathogenic bacteria
Treatment Curative activity/% Protective activity/%
Morbidity Disease index Control efficiency Morbidity Disease index Control efficiency
9 100 31.1 62.2 100 33.3 57.2
CQ 100 42.2 48.7 100 44.4 42.9
Control 100 82.2 – 100 77.8 –
Tab.3  Curative and protective activities of compound 9 against rice BLB under greenhouse conditions at 200 μg·mL–1 in vivo
Fig.1  Growth curve of X. oryzae treated with compound 9.
Fig.2  (a–d) SEM and (e–h) TEM images of X. oryzae treated with compound 9 at concentrations of 0 (a, e, f, control), 0.39 (b, 1/2 MIC), 0.78 (c, g, h, 1 MIC), and 1.56 (d, 2 MIC) μg·mL–1.
Fig.3  Effects of compound 9 treatment on (a) EPS production and (b) biofilm formation of X. oryzae.
Fig.4  (a) Volcano plots and (b) number of DEGs, enrichment of DEGs in (c) GO terms and (d) KEGG pathways.
Fig.5  qRT-PCR analysis of key DEGs.
Fig.6  (a) Relative expression level of the ftsZ gene and (b) predicted binding modes of X. oryzae ftsZ protein with compound 9.
1 P Li, D Hu, D Xie, J Chen, L Jin, B Song. Design, synthesis, and evaluation of new sulfone derivatives containing a 1,3,4-oxadiazole moiety as active antibacterial agents. Journal of Agricultural and Food Chemistry, 2018, 66( 12): 3093– 3100
https://doi.org/10.1021/acs.jafc.7b06061
2 P Y Wang, M W Wang, D Zeng, M Xiang, J R Rao, Q Q Liu, L W Liu, Z B Wu, Z Li, B A Song, S Yang. Rational optimization and action mechanism of novel imidazole (or imidazolium)-labeled 1,3,4-oxadiazole thioethers as promising antibacterial agents against plant bacterial diseases. Journal of Agricultural and Food Chemistry, 2019, 67( 13): 3535– 3545
https://doi.org/10.1021/acs.jafc.8b06242
3 D Zhang, Y Zhou, D Zhao, J Zhu, Z Yang, M Zhu. Complete genome sequence and pathogenic genes analysis of Pectobacterium atroseptica JG10-08. Genes & Genomics, 2017, 39( 9): 945– 955
https://doi.org/10.1007/s13258-017-0559-y
4 S Wu, J Shi, J Chen, D Hu, L Zang, B Song. Synthesis, antibacterial activity, and mechanisms of novel 6-sulfonyl-1,2,4-triazolo[3,4-b][1,3,4]thiadiazole derivatives. Journal of Agricultural and Food Chemistry, 2021, 69( 16): 4645– 4654
https://doi.org/10.1021/acs.jafc.1c01204
5 X J Fan, D Kong, S He, J Z Chen, Y Jiang, Z Q Ma, J T Feng, H Yan. Phenanthrene derivatives from Asarum heterotropoides showed excellent antibacterial activity against phytopathogenic bacteria. Journal of Agricultural and Food Chemistry, 2021, 69( 48): 14520– 14529
https://doi.org/10.1021/acs.jafc.1c04385
6 I Montenegro, M Valenzuela, N Zamorano, R Santander, C Baez, A Madrid. Activity of Adesmia boronioides resinous exudate against phytopathogenic bacteria. Natural Product Research, 2021, 35( 12): 2072– 2075
https://doi.org/10.1080/14786419.2019.1648465
7 L B Lin, Y Q Gao, R Han, J Xiao, Y M Wang, Q Zhang, Y J Zhai, W B Han, W L Li, J M Gao. Alkylated salicylaldehydes and prenylated indole alkaloids from the endolichenic fungus Aspergillus chevalieri and their bioactivities. Journal of Agricultural and Food Chemistry, 2021, 69( 23): 6524– 6534
https://doi.org/10.1021/acs.jafc.1c01148
8 L B Lin, J Xiao, Q Zhang, R Han, B Xu, S X Yang, W B Han, J J Tang, J M Gao. Eremophilane sesquiterpenoids with antibacterial and anti-inflammatory activities from the endophytic fungus Septoria rudbeckiae. Journal of Agricultural and Food Chemistry, 2021, 69( 40): 11878– 11889
https://doi.org/10.1021/acs.jafc.1c04131
9 M Xiang, X Zhou, T R Luo, P Y Wang, L W Liu, Z Li, Z B Wu, S Yang. Design, synthesis, antibacterial evaluation, and induced apoptotic behaviors of epimeric and chiral 18β-glycyrrhetinic acid ester derivatives with an isopropanolamine bridge against phytopathogens. Journal of Agricultural and Food Chemistry, 2019, 67( 48): 13212– 13220
https://doi.org/10.1021/acs.jafc.9b06147
10 M Xiang, Y L Song, J Ji, X Zhou, L W Liu, P Y Wang, Z B Wu, Z Li, S Yang. Synthesis of novel 18β-glycyrrhetinic piperazine amides displaying significant in vitro and in vivo antibacterial activities against intractable plant bacterial diseases. Pest Management Science, 2020, 76( 9): 2959– 2971
https://doi.org/10.1002/ps.5841
11 S Jiang, S Su, M Chen, F Peng, Q Zhou, T Liu, L Liu, W Xue. Antibacterial activities of novel dithiocarbamate-containing 4H-chromen-4-one derivatives. Journal of Agricultural and Food Chemistry, 2020, 68( 20): 5641– 5647
https://doi.org/10.1021/acs.jafc.0c01652
12 S Jiang, X Tang, M Chen, J He, S Su, L Liu, M He, W Xue. Design, synthesis and antibacterial activities against Xanthomonas oryzae pv. oryzae, Xanthomonas axonopodis pv. citri and Ralstonia solanacearum of novel myricetin derivatives containing sulfonamide moiety. Pest Management Science, 2020, 76( 3): 853– 860
https://doi.org/10.1002/ps.5587
13 Y J Chen, H Liu, S Y Zhang, H Li, K Y Ma, Y Q Liu, X D Yin, R Zhou, Y F Yan, R X Wang, Y H He, Q R Chu, C Tang. Design, synthesis, and antifungal evaluation of cryptolepine derivatives against phytopathogenic fungi. Journal of Agricultural and Food Chemistry, 2021, 69( 4): 1259– 1271
https://doi.org/10.1021/acs.jafc.0c06480
14 J Lavrado, G G Cabal, M Prudencio, M M Mota, J Gut, P J Rosenthal, C Diaz, R C Guedes, D J dos Santos, E Bichenkova, K T Douglas, R Moreira, A Paulo. Incorporation of basic side chains into cryptolepine scaffold: structure-antimalarial activity relationships and mechanistic studies. Journal of Medicinal Chemistry, 2011, 54( 3): 734– 750
https://doi.org/10.1021/jm101383f
15 M Figueiras, L Coelho, K J Wicht, S A Santos, J Lavrado, J Gut, P J Rosenthal, F Nogueira, T J Egan, R Moreira, A Paulo. N10,N11-di-alkylamine indolo[3,2-b]quinolines as hemozoin inhibitors: design, synthesis and antiplasmodial activity. Bioorganic & Medicinal Chemistry, 2015, 23( 7): 1530– 1539
https://doi.org/10.1016/j.bmc.2015.02.007
16 R Mudududdla, D Mohanakrishnan, S S Bharate, R A Vishwakarma, D Sahal, S B Bharate. Orally effective aminoalkyl 10H-indolo[3,2-b]quinoline-11-carboxamide kills the malaria parasite by inhibiting host hemoglobin uptake. ChemMedChem, 2018, 13( 23): 2581– 2598
https://doi.org/10.1002/cmdc.201800579
17 J M Yuan, K Wei, G H Zhang, N Y Chen, X W Wei, C X Pan, D L Mo, G F Su. Cryptolepine and aromathecin based mimics as potent G-quadruplex-binding, DNA-cleavage and anticancer agents: design, synthesis and DNA targeting-induced apoptosis. European Journal of Medicinal Chemistry, 2019, 169 : 144– 158
https://doi.org/10.1016/j.ejmech.2019.02.072
18 Q P Qin, Z Z Wei, Z F Wang, X L Huang, M X Tan, H H Zou, H Liang. Imaging and therapeutic applications of Zn(II)-cryptolepine-curcumin molecular probes in cell apoptosis detection and photodynamic therapy. Chemical Communications (Cambridge), 2020, 56( 28): 3999– 4002
https://doi.org/10.1039/D0CC00524J
19 O A Olajide, A M Ajayi, C W Wright. Anti-inflammatory properties of cryptolepine. Phytotherapy Research, 2009, 23( 10): 1421– 1425
https://doi.org/10.1002/ptr.2794
20 O A Olajide, H S Bhatia, A C de Oliveira, C W Wright, B L Fiebich. Anti-neuroinflammatory properties of synthetic cryptolepine in human neuroblastoma cells: possible involvement of NF-kappaB and p38 MAPK inhibition. European Journal of Medicinal Chemistry, 2013, 63 : 333– 339
https://doi.org/10.1016/j.ejmech.2013.02.004
21 H Rasouli, R Yarani, F Pociot, J Popovic-Djordjevic. Anti-diabetic potential of plant alkaloids: revisiting current findings and future perspectives. Pharmacological Research, 2020, 155 : 104723– 104737
https://doi.org/10.1016/j.phrs.2020.104723
22 S Y Ablordeppey, P C Fan, S M Li, A M Clark, C D Hufford. Substituted indoloquinolines as new antifungal agents. Bioorganic & Medicinal Chemistry, 2002, 10( 5): 1337– 1346
https://doi.org/10.1016/S0968-0896(01)00401-1
23 C A Boateng, X Y Zhu, M R Jacob, S I Khan, L A Walker, S Y Ablordeppey. Optimization of 3-(phenylthio)quinolinium compounds against opportunistic fungal pathogens. European Journal of Medicinal Chemistry, 2011, 46( 5): 1789– 1797
https://doi.org/10.1016/j.ejmech.2011.02.034
24 M Zhao, T Kamada, A Takeuchi, H Nishioka, T Kuroda, Y Takeuchi. Structure-activity relationship of indoloquinoline analogs anti-MRSA. Bioorganic & Medicinal Chemistry Letters, 2015, 25( 23): 5551– 5554
https://doi.org/10.1016/j.bmcl.2015.10.058
25 N Sun, R L Du, Y Y Zheng, B H Huang, Q Guo, R F Zhang, K Y Wong, Y J Lu. Antibacterial activity of N-methylbenzofuro[3,2-b]quinoline and N-methylbenzoindolo[3,2-b]-quinoline derivatives and study of their mode of action. European Journal of Medicinal Chemistry, 2017, 135 : 1– 11
https://doi.org/10.1016/j.ejmech.2017.04.018
26 S Gibbons, F Fallah, C W Wright. Cryptolepine hydrochloride: a potent antimycobacterial alkaloid derived from Cryptolepis sanguinolenta. Phytotherapy Research, 2003, 17( 4): 434– 436
https://doi.org/10.1002/ptr.1284
27 N Tuyiringire, S Deyno, A Weisheit, C U Tolo, D Tusubira, J P Munyampundu, P E Ogwang, C M Muvunyi, Y V Heyden. Three promising antimycobacterial medicinal plants reviewed as potential sources of drug hit candidates against multidrug-resistant tuberculosis. Tuberculosis (Edinburgh, Scotland), 2020, 124 : 101987– 101994
https://doi.org/10.1016/j.tube.2020.101987
28 Q R Chu, Y H He, C Tang, Z J Zhang, X F Luo, B Q Zhang, Y Zhou, T L Wu, S S Du, C J Yang, Y Q Liu. Design, synthesis, and antimicrobial activity of quindoline derivatives inspired by the cryptolepine alkaloid. Journal of Agricultural and Food Chemistry, 2022, 70( 9): 2851– 2863
https://doi.org/10.1021/acs.jafc.1c07536
29 I Wiegand, K Hilpert, R E Hancock. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature Protocols, 2008, 3( 2): 163– 175
https://doi.org/10.1038/nprot.2007.521
30 T Fan, W Guo, T Shao, W Zhou, P Hu, M Liu, Y Chen, Z Yi. Design, synthesis and evaluation of phenylthiazole and phenylthiophene pyrimidindiamine derivatives targeting the bacterial membrane. European Journal of Medicinal Chemistry, 2020, 190 : 112141– 112153
https://doi.org/10.1016/j.ejmech.2020.112141
31 J Chen, Y Luo, C Wei, S Wu, R Wu, S Wang, D Hu, B Song. Novel sulfone derivatives containing a 1,3,4-oxadiazole moiety: design and synthesis based on the 3D-QSAR model as potential antibacterial agent. Pest Management Science, 2020, 76( 9): 3188– 3198
https://doi.org/10.1002/ps.5873
32 C F Yi, J X Chen, C Q Wei, S K Wu, S B Wang, D Y Hu, B A Song. α-Haloacetophenone and analogues as potential antibacterial agents and nematicides. Bioorganic & Medicinal Chemistry Letters, 2020, 30( 2): 126814– 126818
https://doi.org/10.1016/j.bmcl.2019.126814
33 S Kang, F Kong, X Shi, H Han, M Li, B Guan, M Yang, X Cao, D Tao, Y Zheng, X Yue. Antibacterial activity and mechanism of lactobionic acid against Pseudomonas fluorescens and Methicillin-resistant Staphylococcus aureus and its application on whole milk. Food Control, 2020, 108 : 106876– 106885
https://doi.org/10.1016/j.foodcont.2019.106876
34 L Zhao, F Duan, M Gong, X Tian, Y Guo, L Jia, S Deng. (+)-Terpinen-4-ol inhibits Bacillus cereus biofilm formation by upregulating the interspecies quorum sensing signals diketopiperazines and diffusing signaling factors. Journal of Agricultural and Food Chemistry, 2021, 69( 11): 3496– 3510
https://doi.org/10.1021/acs.jafc.0c07826
35 L Qi, H Li, C Zhang, B Liang, J Li, L Wang, X Du, X Liu, S Qiu, H Song. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Frontiers in Microbiology, 2016, 7 : 483– 492
https://doi.org/10.3389/fmicb.2016.00483
36 J W Zhou, L Y Ruan, H J Chen, H Z Luo, H Jiang, J S Wang, A Q Jia. Inhibition of quorum sensing and virulence in Serratia marcescens by hordenine. Journal of Agricultural and Food Chemistry, 2019, 67( 3): 784– 795
https://doi.org/10.1021/acs.jafc.8b05922
37 T K Beuria, M K Santra, D Panda. Sanguinarine blocks cytokinesis in bacteria by inhibiting FtsZ assembly and bundling. Biochemistry, 2005, 44( 50): 16584– 16593
https://doi.org/10.1021/bi050767+
38 P N Domadia, A Bhunia, J Sivaraman, S Swarup, D Dasgupta. Berberine targets assembly of Escherichia coli cell division protein FtsZ. Biochemistry, 2008, 47( 10): 3225– 3234
https://doi.org/10.1021/bi7018546
[1] FCE-22024-OF-HY_suppl_1 Download
[1] Mani Abirami, Krishnan Kannabiran. Streptomyces ghanaensis VITHM1 mediated green synthesis of silver nanoparticles: Mechanism and biological applications[J]. Front. Chem. Sci. Eng., 2016, 10(4): 542-551.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed