Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers of Environmental Science & Engineering

ISSN 2095-2201

ISSN 2095-221X(Online)

CN 10-1013/X

Postal Subscription Code 80-973

2018 Impact Factor: 3.883

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Environ. Sci. Eng.    2021, Vol. 15 Issue (5) : 84    https://doi.org/10.1007/s11783-020-1378-y
REVIEW ARTICLE
Bacteriophages in water pollution control: Advantages and limitations
Mengzhi Ji1, Zichen Liu1, Kaili Sun1, Zhongfang Li2(), Xiangyu Fan1(), Qiang Li1
1. School of Biological Science and Technology, University of Jinan, Jinan 250022, China
2. College of Food and Bioengineering, Hezhou University, Hezhou 542899, China
 Download: PDF(957 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

•Phages can be better indicators of enteric viruses than fecal indicator bacteria.

•Multiple phages should be added to the microbial source tracking toolbox.

•Engineered phage or phage cocktail can effectively target resistant bacteria.

•In phage use, phage-mediated horizontal gene transfer cannot be ignored.

•More schemes are needed to prevent phage concentration from decreasing.

Wastewater is a breeding ground for many pathogens, which may pose a threat to human health through various water transmission pathways. Therefore, a simple and effective method is urgently required to monitor and treat wastewater. As bacterial viruses, bacteriophages (phages) are the most widely distributed and abundant organisms in the biosphere. Owing to their capacity to specifically infect bacterial hosts, they have recently been used as novel tools in water pollution control. The purpose of this review is to summarize and evaluate the roles of phages in monitoring pathogens, tracking pollution sources, treating pathogenic bacteria, infecting bloom-forming cyanobacteria, and controlling bulking sludge and biofilm pollution in wastewater treatment systems. We also discuss the limitations of phage usage in water pollution control, including phage-mediated horizontal gene transfer, the evolution of bacterial resistance, and phage concentration decrease. This review provides an integrated outlook on the use of phages in water pollution control.
Keywords Phage      Water pollution monitoring      Harmful bacteria biocontrol      Horizontal gene transfer      Bacterial resistance     
Corresponding Author(s): Zhongfang Li,Xiangyu Fan   
Issue Date: 07 December 2020
 Cite this article:   
Mengzhi Ji,Zichen Liu,Kaili Sun, et al. Bacteriophages in water pollution control: Advantages and limitations[J]. Front. Environ. Sci. Eng., 2021, 15(5): 84.
 URL:  
https://academic.hep.com.cn/fese/EN/10.1007/s11783-020-1378-y
https://academic.hep.com.cn/fese/EN/Y2021/V15/I5/84
Fig.1  The advantages of phages in controlling wastewater contamination.
Phages Monitoring water quality Tracking human faecal sources Reference
Coliphages Somatic coliphages (e.g. phages of E. coli strain WG5) Dias et al., 2018
F-RNA coliphages (geno-groups I is more accurate.) F-RNA coliphages (geno-groups II and III) Hagedorn et al., 2011; Haramoto et al., 2015; Amarasiri et al., 2017
Bacteroides phages B. fragilis (e.g. RYC2056, GB124) phages B. fragilis (e.g. GB124, and HSP40) phages Jofre et al., 2014; Diston et al., 2015; Hodgson et al., 2017; McMinn et al., 2017
B. thetaiotaomicron (e.g. GA-17 and ARABA 84) phages B. thetaiotaomicron (e.g. GA-17 and ARABA 84) phages Jofre et al., 2014; Diston and Wicki, 2015
CrAssphage CrAssphage Ahmed et al., 2018; Wu et al., 2020
Phages of Bacteroides HB-73 Phages of Bacteroides HB-73 Vijayavel et al., 2010
Enterococcus phages E. faecalis (e.g. AIM06 and SR14) phages E. faecalis (e.g. AIM06 and SR14) phages Wangkahad et al., 2017; Chyerochana et al., 2020
E. faecium (e.g. ENT-49 and ENT-55) phages E. faecium (e.g. MW47) phages Vijayavel et al., 2014; Purnell et al., 2018
Tab.1  Phages commonly used to evaluate water quality
qPCR Assay Primer/Probe Sequence 5′ - 3′ Reference
CPQ_056 Forward primer CAGAAGTACAAACTCCTAAAAAACGTAGAG Stachler et al., 2017; Wu et al., 2020
Reverse primer GATGACCAATAAACAAGCCATTAGC
Probe [FAM]AATAACGATTTACGTGATGTAAC[MGB]
CPQ_064 Forward primer TGTATAGATGCTGCTGCAACTGTACTC Stachler et al., 2017
Reverse primer CGTTGTTTTCATCTTTATCTTGTCCAT
Probe [FAM]CTGAAATTGTTCATAAGCAA[MGB]
Forward primer AGGAGAAAGTGAACGTGGAAACA García‐Aljaro et al., 2017
Reverse primer AACGAGCACCAACTTTAAGCTTTA
Probe [FAM]AGGATTTGGAGAAGGAA[MGBNFQ]
Forward primer GAATCTAAAGGTGCTCTTAATCCTATGAT Liang et al., 2018
Reverse primer CCTACATTTTGAGTAAGACAAAAGTCAAG
Probe [FAM]TGCCTATTGTTGCTCAAG[MGB]
Forward primer GGTAAGAATATTACTGAATATCCTACTTG Cinek et al., 2018
Reverse primer CAATCATGTTCATCAATAAAYGCTTCA
Probe [FAM]ATGATATTAATTATCTTACTGGAGATGAACCTACAAGACAAAC[BHQ]
Tab.2  Primers and probes for crAssphage for the qPCR assay
Isolated phages Sample source Classification
of phages		 Pathogenic bacteria The effect achieved Reference
Coliphages Zayandehrood River Podoviridae Myoviridae Escherichia coli A mixture of coliphages can reduce the most probable number (MPN) of coliforms in sewage by 22 times. Maal et al., 2015
?AB2 Wastewater and raw sewage Podoviridae Acinetobacter baumannii ?AB2 can make A. baumannii strains almost completely lysis. Lin et al., 2010
pSs-1 Environmental water in South Korea Myoviridae Shigella The combination of phages can control all strains of Shigella. Jun et al., 2016
ICP1
ICP2
ICP3		 Stool samples from Bangladeshi cholera patient Myoviridae
Podoviridae
Podoviridae		 Vibrio cholerae A mixture of three ICP phages can target the elimination of Vibrio cholerae and provide a phage cocktail therapy to prevent cholera. Yen et al., 2017
sww297
sww65
sww275		 Raw wastewater from Tunisia Podoviridae
Siphoviridae
Siphoviridae		 Salmonella A mixture of three phages can eliminate Salmonella. Turki et al., 2012
LK1 Sewage Podoviridae Citrobacter freundii LK1 have a relatively narrow host range and better tolerance, which make it control the growth of Citrobacter freundii well. Chaudhry et al., 2014
MAG1
MAG4		 Sewage from WWTP Myoviridae
Podoviridae		 Pseudomonas aeruginosa A mixture of MAG1 and MAG4 can lyse almost all bacterial cells. Kwiatek et al., 2017
vB_Klp_5
vB_Klox_2		 Sewage from Mtkvari River Podoviridae
Podoviridae		 Klebsiella One or more phages were capable of lysing a large part of strains. Karumidze et al., 2013
Tab.3  Isolation of phages for specific pathogens
Fig.2  The limitations of phages in controlling wastewater contamination. 1. Phage concentration decrease due to off-target adsorption. 2. Restriction-modification systems can recognize and destroy phage DNA. 3. CRISPR-Cas systems provide bacteria with adaptive immunity against phages. 4. Phages can transfer ARGs and virulence genes between bacterial communities. 5. Abortive infection mechanisms provide population protection in different stages of the lytic cycle.
Fig.3  Phage-mediated horizontal gene transfer mechanisms. (a) After the invasion of temperate phages into their hosts, their DNA (green) is injected and replicated along with the replication of host DNA. In this process, prophages may package some DNA fragments (brown) of the host. Under spontaneous induction or environmental stress, the lysogenic cycle is terminated. Phages enter the lytic cycle and release progeny phages, which can invade other host cells and transfer genes. (b) Generalized transduction packs random fragments of the host DNA (brown) into the viral capsid. When progeny phages are released, they transfer genes between bacteria.
Test sample source Types of ARGs carried by phages Reference
Soil sul1, qnrA, armA, blaCTX-M-1, blaOXA-48,blaTEM Larrañaga et al., 2018
The Funan River aac(6′)-lb-cr, aph(3′)-IIIa, blaCTX-M, ermF, sul1, sul2 Yang et al., 2018
Sewage from WWTP blaTEM, blaOXA-48, blaPSE, blaCTX-M, blaKPC, blaCMY-2, blaNDM-1 Zhang et al., 2019
Chicken feces aac(6′)-lb-cr, aph(3′)-IIIa, blaCTX-M, ermB, ermF, floR, mcr-1, qnrS, sul1, sul2, tetM, vanA Yang et al., 2020
Human fecal samples blaTEM, blaCTX-M-1, blaCTX-M-9, armA, qnrA, qnrS, sul1, blaOXA-48, mecA Brown-Jaque et al., 2018
A river receiving treated wastewater discharges qnrS, ermB, sul1, tetW , blaTEM, blaNDM, blaKPC, vanA Lekunberri et al., 2017b
Pig fecal sul1, blaTEM, ermB, qnrA, qnrS, fexA, floR,
aac(6)-Ib-cr, cfr,, tetM, blaCTXM-1		 Wang et al., 2018
Water and sediment blaTEM, sul1, blaCTX-M, qnrA, qnrS, mecA Calero-Cáceres et al., 2017
Tab.4  The situation of phage particles harboring ARGs
1 W Ahmed, A Lobos, J Senkbeil, J Peraud, J Gallard, V J Harwood (2018). Evaluation of the novel crAssphage marker for sewage pollution tracking in storm drain outfalls in Tampa, Florida. Water Research, 131: 142–150
https://doi.org/10.1016/j.watres.2017.12.011
2 M Amarasiri, M Kitajima, T H Nguyen, S Okabe, D Sano (2017). Bacteriophage removal efficiency as a validation and operational monitoring tool for virus reduction in wastewater reclamation. Water Research, 121: 258–269
https://doi.org/10.1016/j.watres.2017.05.035
3 S Aracic, S Manna, S Petrovski, J L Wiltshire, G Mann, A E Franks (2015). Innovative biological approaches for monitoring and improving water quality. Frontiers in Microbiology, 6: 826
https://doi.org/10.3389/fmicb.2015.00826
4 S Ayyaru, J Choi, Y H Ahn (2018). Biofouling reduction in a MBR by the application of a lytic phage on a modified nanocomposite membrane. Environmental Science. Water Research & Technology, 4(10): 1624–1638
https://doi.org/10.1039/C8EW00316E
5 K Bányai, M K Estes, V Martella, U D Parashar (2018). Viral gastroenteritis. Lancet, 392(10142): 175–186
https://doi.org/10.1016/S0140-6736(18)31128-0
6 S Batinovic, F Wassef, S A Knowler, D T Rice, C R Stanton, J Rose, J Tucci, T Nittami, A Vinh, G R Drummond, C G Sobey, H T Chan, R J Seviour, S Petrovski, A E Franks (2019). Bacteriophages in Natural and Artificial Environments. Pathogens (Basel, Switzerland), 8(3): 100
https://doi.org/10.3390/pathogens8030100
7 A S Bhattacharjee, J Choi, A M Motlagh, S T Mukherji, R Goel (2015). Bacteriophage therapy for membrane biofouling in membrane bioreactors and antibiotic‐resistant bacterial biofilms. Biotechnology and Bioengineering, 112(8): 1644–1654
https://doi.org/10.1002/bit.25574
8 A Bivins, K Crank, J Greaves, D North, Z Wu, K Bibby (2020). Cross-assembly phage and pepper mild mottle virus as viral water quality monitoring tools–potential, research gaps, and way forward. Current Opinion in Environmental Science & Health, 16: 54-61
https://doi.org/10.1016/j.coesh.2020.02.001
9 M Brown-Jaque, W Calero-Cáceres, P Espinal, J Rodríguez-Navarro, E Miró, J J González-López, T Cornejo, J C, Hurtado F Navarro, M Muniesa (2018). Antibiotic resistance genes in phage particles isolated from human faeces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents, 51(3): 434–442
https://doi.org/10.1016/j.ijantimicag.2017.11.014
10 W Calero-Cáceres, J Méndez, J Martín-Díaz, M Muniesa (2017). The occurrence of antibiotic resistance genes in a Mediterranean river and their persistence in the riverbed sediment. Environmental Pollution, 223: 384–394
https://doi.org/10.1016/j.envpol.2017.01.035
11 W Calero-Cáceres, M Muniesa (2016). Persistence of naturally occurring antibiotic resistance genes in the bacteria and bacteriophage fractions of wastewater. Water Research, 95: 11–18
https://doi.org/10.1016/j.watres.2016.03.006
12 W Calero-Cáceres, M Ye, J L Balcázar (2019). Bacteriophages as environmental reservoirs of antibiotic resistance. Trends in microbiology, 27(7): 570–577
https://doi.org/10.1016/j.tim.2019.02.008
13 W N Chaudhry, I U Haq, S Andleeb, I Qadri (2014). Characterization of a virulent bacteriophage LK1 specific for Citrobacter freundii isolated from sewage water. Journal of Basic Microbiology, 54(6): 531–541
https://doi.org/10.1002/jobm.201200710
14 J Chen, N Carpena, N Quiles-Puchalt, G Ram, R P Novick, J R Penadés (2015). Intra-and inter-generic transfer of pathogenicity island-encoded virulence genes by cos phages. ISME Journal, 9(5): 1260–1263
https://doi.org/10.1038/ismej.2014.187
15 X Cheng, H M Delanka-Pedige, S P Munasinghe-Arachchige, I S Abeysiriwardana-Arachchige, G B Smith, N Nirmalakhandan, Y Zhang (2020). Removal of antibiotic resistance genes in an algal-based wastewater treatment system employing Galdieria sulphuraria: A comparative study. Science of the Total Environment, 711: 134435
https://doi.org/10.1016/j.scitotenv.2019.134435
16 N Chyerochana, A Kongprajug, P Somnark, P Leelapanang Kamphaengthong, S Mongkolsuk, K Sirikanchana (2020). Distributions of enterococci and human-specific bacteriophages of enterococci in a tropical watershed. International Journal of Hygiene and Environmental Health, 226: 113482
https://doi.org/10.1016/j.ijheh.2020.113482
17 O Cinek, K Mazankova, L Kramna, R Odeh, A Alassaf, M U Ibekwe, G Ahmadov, H Mekki, M A Abdullah, B M Elmahi, H Hyöty, P Rainetova (2018). Quantitative CrAssphage real-time PCR assay derived from data of multiple geographically distant populations. Journal of Medical Virology, 90(4): 767–771
https://doi.org/10.1002/jmv.25012
18 K Crank, X Li, D North, G B Ferraro, M Iaconelli, P Mancini, G La Rosa, K Bibby (2020). CrAssphage abundance and correlation with molecular viral markers in Italian wastewater. Water Research, 184: 116161
https://doi.org/10.1016/j.watres.2020.116161
19 A de Brauwere, N K Ouattara, P Servais (2014). Modeling fecal indicator bacteria concentrations in natural surface waters: A review. Critical Reviews in Environmental Science and Technology, 44(21): 2380–2453
https://doi.org/10.1080/10643389.2013.829978
20 Y Deng, B Li, T Zhang (2018). Bacteria that make a meal of sulfonamide antibiotics: Blind spots and emerging opportunities. Environmental Science & Technology, 52(7): 3854–3868
https://doi.org/10.1021/acs.est.7b06026
21 E Dias, J Ebdon, H Taylor (2018). The application of bacteriophages as novel indicators of viral pathogens in wastewater treatment systems. Water Research, 129: 172–179
https://doi.org/10.1016/j.watres.2017.11.022
22 D Diston, M Sinreich, S Zimmermann, A Baumgartner, R Felleisen (2015). Evaluation of molecular-and culture-dependent MST markers to detect fecal contamination and indicate viral presence in good quality groundwater. Environmental Science & Technology, 49(12): 7142–7151
https://doi.org/10.1021/acs.est.5b00515
23 D Diston, M Wicki (2015). Occurrence of bacteriophages infecting Bacteroides host strains (ARABA 84 and GB-124) in fecal samples of human and animal origin. Journal of Water and Health, 13(3): 654–661
https://doi.org/10.2166/wh.2014.199
24 J Doss, K Culbertson, D Hahn, J Camacho, N Barekzi (2017). A review of phage therapy against bacterial pathogens of aquatic and terrestrial organisms. Viruses, 9(3): 50
https://doi.org/10.3390/v9030050
25 P Dow, K Kotz, S Gruszka, J Holder, J Fiering (2018). Acoustic separation in plastic microfluidics for rapid detection of bacteria in blood using engineered bacteriophage. Lab on a Chip, 18(6): 923–932
https://doi.org/10.1039/C7LC01180F
26 B E Dutilh, N Cassman, K Mcnair, S E Sanchez, G G Silva, L Boling, J J Barr, D R Speth, V Seguritan, R K Aziz, B Felts, E A Dinsdale, J L Mokili, R A Edwards (2014). A highly abundant bacteriophage discovered in the unknown sequences of human faecal metagenomes. Nature Communications, 5(1): 4498
https://doi.org/10.1038/ncomms5498
27 R A Edwards, A A Vega, H M Norman, M Ohaeri, K Levi, E A Dinsdale, O Cinek, R K Aziz, K Mcnair, J J Barr, K Bibby, S J J Brouns, A Cazares, P A de Jonge, C Desnues, S L Díaz Muñoz, P C Fineran, A Kurilshikov, R Lavigne, K Mazankova, D T McCarthy, F L Nobrega, A Reyes Muñoz, G Tapia, N Trefault, A V Tyakht, P Vinuesa, J Wagemans, A Zhernakova, F M Aarestrup, G Ahmadov, A Alassaf, J Anton, A Asangba, E K Billings, V A Cantu, J M Carlton, D Cazares, G S Cho, T Condeff, P Cortés, M Cranfield, D A Cuevas, R De la Iglesia, P Decewicz, M P Doane, N J Dominy, L Dziewit, B M Elwasila, A M Eren, C Franz, J Fu, C Garcia-Aljaro, E Ghedin, K M Gulino, J M Haggerty, S R Head, R S Hendriksen, C Hill, H Hyöty, E N Ilina, M T Irwin, T C Jeffries, J Jofre, R E Junge, S T Kelley, M Khan Mirzaei, M Kowalewski, D Kumaresan, S R Leigh, D Lipson, E S Lisitsyna, M Llagostera, J M Maritz, L C Marr, A McCann, S Molshanski-Mor, S Monteiro, B Moreira-Grez, M Morris, L Mugisha, M Muniesa, H Neve, N Nguyen, O D Nigro, A S Nilsson, T O’Connell, R Odeh, A Oliver, M Piuri, A J Prussin II, U Qimron, Z X Quan, P Rainetova, A Ramírez-Rojas, R Raya, K Reasor, G A O Rice, A Rossi, R Santos, J Shimashita, E N Stachler, L C Stene, R Strain, R Stumpf, P J Torres, A Twaddle, M A Ugochi Ibekwe, N Villagra, S Wandro, B White, A Whiteley, K L Whiteson, C Wijmenga, M M Zambrano, H Zschach, B E Dutilh (2019). Global phylogeography and ancient evolution of the widespread human gut virus crAssphage. Nature Microbiology, 4(10): 1727–1736
https://doi.org/10.1038/s41564-019-0494-6
28 G Ertürk, R Lood (2018). Bacteriophages as biorecognition elements in capacitive biosensors: Phage and host bacteria detection. Sensors and Actuators. B, Chemical, 258: 535–543
https://doi.org/10.1016/j.snb.2017.11.117
29 K Farkas, D I Walker, E M Adriaenssens, J E Mcdonald, L S Hillary, S K Malham, D L Jones (2020). Viral indicators for tracking domestic wastewater contamination in the aquatic environment. Water Research, 181: 115926
https://doi.org/10.1016/j.watres.2020.115926
30 N Gabiatti, P Yu, J Mathieu, G W Lu, X Wang, H Zhang, H M Soares, P J Alvarez (2018). Bacterial endospores as phage genome carriers and protective shells. Applied and Environmental Microbiology, 84(18): e01186-18
https://doi.org/10.1128/AEM.01186-18
31 E B Gao, J F Gui, Q Y Zhang (2012). A novel cyanophage with a cyanobacterial nonbleaching protein A gene in the genome. Journal of Virology, 86(1): 236–245
https://doi.org/10.1128/JVI.06282-11
32 C García‐Aljaro, E Ballesté M Muniesa, J Jofre (2017). Determination of crAssphage in water samples and applicability for tracking human faecal pollution. Microbial Biotechnology, 10(6): 1775–1780 doi:10.1111/1751-7915.12841
33 J Gu, B Han, J Wang (2020). COVID-19: gastrointestinal manifestations and potential fecal-oral transmission. Gastroenterology, 158(6): 1518–1519
https://doi.org/10.1053/j.gastro.2020.02.054
34 C Guzmán, L Mocé-Llivina, F Lucena, J Jofre (2008). Evaluation of Escherichia coli host strain CB390 for simultaneous detection of somatic and F-specific coliphages. Applied and Environmental Microbiology, 74(2): 531–534
https://doi.org/10.1128/AEM.01710-07
35 C Hagedorn, A R Blanch, V J Harwood (2011). Microbial Source Tracking: Methods, Applications, and Case Studies. Dordrecht: Springer Science & Business Media
36 H G Hampton, B N Watson, P C Fineran (2020). The arms race between bacteria and their phage foes. Nature, 577(7790): 327–336
https://doi.org/10.1038/s41586-019-1894-8
37 I A Hamza, K Bibby (2019). Critical issues in application of molecular methods to environmental virology. Journal of Virological Methods, 266: 11–24
https://doi.org/10.1016/j.jviromet.2019.01.008
38 E Haramoto, S Fujino, M Otagiri (2015). Distinct behaviors of infectious F-specific RNA coliphage genogroups at a wastewater treatment plant. Science of the Total Environment, 520: 32–38
https://doi.org/10.1016/j.scitotenv.2015.03.034
39 K R Hodgson, V A Torok, A R Turnbull (2017). Bacteriophages as enteric viral indicators in bivalve mollusc management. Food Microbiology, 65: 284–293
https://doi.org/10.1016/j.fm.2017.03.003
40 S A Jassim, R G Limoges (2013). Impact of external forces on cyanophage–host interactions in aquatic ecosystems. World Journal of Microbiology & Biotechnology, 29(10): 1751–1762
https://doi.org/10.1007/s11274-013-1358-5
41 S A Jassim, R G Limoges, H El-Cheikh (2016). Bacteriophages biocontrol in wastewater treatment. World Journal of Microbiology & Biotechnology, 32(4): 70
https://doi.org/10.1007/s11274-0.16-2028-1
42 S A Jassim, R G Limoges (2017). Bacteriophages: Practical Applications for Nature’s Biocontrol. Dordrecht: Springer
43 J Jofre, A R Blanch, F Lucena, M Muniesa (2014). Bacteriophages infecting Bacteroides as a marker for microbial source tracking. Water Research, 55: 1–11
https://doi.org/10.1016/j.watres.2014.02.006
44 J Jofre, F Lucena, A R Blanch, M Muniesa (2016). Coliphages as model organisms in the characterization and management of water resources. Water (Basel), 8(5): 199
https://doi.org/10.3390/w8050199
45 J W Jun, S S Giri, H J Kim, S K Yun, C Chi, J Y Chai, B C Lee, S C Park (2016). Bacteriophage application to control the contaminated water with Shigella. Scientific Reports, 6: 22636
https://doi.org/10.1038/srep22636
46 N Karumidze, I Kusradze, S Rigvava, M Goderdzishvili, K Rajakumar, Z Alavidze (2013). Isolation and characterisation of lytic bacteriophages of Klebsiella pneumoniae and Klebsiella oxytoca. Current Microbiology, 66(3): 251–258
https://doi.org/10.1007/s00284-012-0264-7
47 F M Khan, R Gupta (2020). Escherichia coli (E. coli) as an Indicator of Fecal Contamination in Groundwater: A Review. New York: Springer, 225–235
48 S M Kotay, T Datta, J Choi, R Goel (2011). Biocontrol of biomass bulking caused by Haliscomenobacter hydrossis using a newly isolated lytic bacteriophage. Water Research, 45(2): 694–704
https://doi.org/10.1016/j.watres.2010.08.038
49 M Kwiatek, S Parasion, P Rutyna, L Mizak, R Gryko, M Niemcewicz, A Olender, M Łobocka (2017). Isolation of bacteriophages and their application to control Pseudomonas aeruginosa in planktonic and biofilm models. Research in Microbiology, 168(3): 194–207
https://doi.org/10.1016/j.resmic.2016.10.009
50 O Larrañaga, M Brown-Jaque, P Quirós, C Gómez-Gómez, A R Blanch, L Rodríguez-Rubio, M Muniesa (2018). Phage particles harboring antibiotic resistance genes in fresh-cut vegetables and agricultural soil. Environment International, 115: 133–141
https://doi.org/10.1016/j.envint.2018.03.019
51 I Lekunberri, J Subirats, C M Borrego, J L Balcázar (2017a). Exploring the contribution of bacteriophages to antibiotic resistance. Environmental Pollution, 220: 981–984
https://doi.org/10.1016/j.envpol.2016.11.059
52 I Lekunberri, M Villagrasa, J L Balcázar, C M Borrego (2017b). Contribution of bacteriophage and plasmid DNA to the mobilization of antibiotic resistance genes in a river receiving treated wastewater discharges. Science of the Total Environment, 601-602: 206–209
https://doi.org/10.1016/j.scitotenv.2017.05.174
53 S S Leung, S Morales, W Britton, E Kutter, H K Chan (2018). Microfluidic-assisted bacteriophage encapsulation into liposomes. International Journal of Pharmaceutics, 545(1–2): 176–182
https://doi.org/10.1016/j.ijpharm.2018.04.063
54 B Li, F Ju, L Cai, T Zhang (2015). Profile and fate of bacterial pathogens in sewage treatment plants revealed by high-throughput metagenomic approach. Environmental Science & Technology, 49(17): 10492–10502
https://doi.org/10.1021/acs.est.5b02345
55 L L Li, P Yu, X Wang, S S Yu, J Mathieu, H Q Yu, P J Alvarez (2017). Enhanced biofilm penetration for microbial control by polyvalent phages conjugated with magnetic colloidal nanoparticle clusters (CNCs). Environmental Science. Nano, 4(9): 1817–1826
https://doi.org/10.1039/C7EN00414A
56 Y Liang, X Jin, Y Huang, S Chen (2018). Development and application of a real-time polymerase chain reaction assay for detection of a novel gut bacteriophage (CrAssphage). Journal of Medical Virology, 90(3): 464–468
https://doi.org/10.1002/jmv.24974
57 N T Lin, P Y Chiou, K C Chang, L K Chen, M J Lai (2010). Isolation and characterization of AB2: A novel bacteriophage of Acinetobacter baumannii. Research in Microbiology, 161(4): 308–314
https://doi.org/10.1016/j.resmic.2010.03.007
58 M Liu, J J Gill, R Young, E J Summer (2015). Bacteriophages of wastewater foaming-associated filamentous Gordonia reduce host levels in raw activated sludge. Scientific Reports, 5(1): 13754
https://doi.org/10.1038/srep13754
59 T K Lu, J J Collins (2007). Dispersing biofilms with engineered enzymatic bacteriophage. Proceedings of the National Academy of Sciences of the United States of America, 104(27): 11197–11202
https://doi.org/10.1073/pnas.0704624104
60 K B Maal, A S Delfan, S Salmanizadeh (2015). Isolation and identification of two novel Escherichia Coli bacteriophages and their application in wastewater treatment and coliform’s phage therapy. Jundishapur Journal of Microbiology, 8(3): e14945
https://doi.org/10.5812/jjm.14945
61 J Mathieu, P Yu, P Zuo, M L Da Silva, P J Alvarez (2019). Going viral: Emerging opportunities for phage-based bacterial control in water treatment and reuse. Accounts of Chemical Research, 52(4): 849–857
https://doi.org/10.1021/acs.accounts.8b00576
62 B R McMinn, N J Ashbolt, A Korajkic (2017). Bacteriophages as indicators of faecal pollution and enteric virus removal. Letters in Applied Microbiology, 65(1): 11–26
https://doi.org/10.1111/lam.12736
63 M Moazeni, M Nikaeen, M Hadi, S Moghim, L Mouhebat, M Hatamzadeh, A Hassanzadeh (2017). Estimation of health risks caused by exposure to enteroviruses from agricultural application of wastewater effluents. Water Research, 125: 104–113
https://doi.org/10.1016/j.watres.2017.08.028
64 R Monteiro, D P Pires, A R Costa, J Azeredo (2019). Phage therapy: going temperate? Trends in Microbiology, 27(4): 368–378
https://doi.org/10.1016/j.tim.2018.10.008
65 A M Motlagh, A S Bhattacharjee, R Goel (2016). Biofilm control with natural and genetically-modified phages. World Journal of Microbiology & Biotechnology, 32(4): 67
https://doi.org/10.1007/s11274-016-2009-4
66 M Muniesa, E Ballesté, L Imamovic, M Pascual-Benito, D Toribio-Avedillo, F Lucena, A Blanch, J Jofre (2018). Bluephage: A rapid method for the detection of somatic coliphages used as indicators of fecal pollution in water. Water Research, 128: 10–19
https://doi.org/10.1016/j.watres.2017.10.030
67 S Petrovski, R J Seviour, D Tillett (2011a). Characterization of the genome of the polyvalent lytic bacteriophage GTE2, which has potential for biocontrol of Gordonia-, Rhodococcus-, and Nocardia-stabilized foams in activated sludge plants. Applied and Environmental Microbiology, 77(12): 3923–3929
https://doi.org/10.1128/AEM.00025-11
68 S Petrovski, R J Seviour, D Tillett (2011b). Prevention of Gordonia and Nocardia stabilized foam formation by using bacteriophage GTE7. Applied and Environmental Microbiology, 77(21): 7864–7867
https://doi.org/10.1128/AEM.05692-11
69 D P Pires, L D R Melo, D Vilas Boas, S Sillankorva, J Azeredo (2017). Phage therapy as an alternative or complementary strategy to prevent and control biofilm-related infections. Current Opinion in Microbiology, 39: 48–56
https://doi.org/10.1016/j.mib.2017.09.004
70 S Purnell, J Ebdon, H Wilkins, H Taylor (2018). Human-specific phages infecting Enterococcus host strain MW47: are they reliable microbial source tracking markers? Journal of Applied Microbiology, 124(5): 1274–1282
https://doi.org/10.1111/jam.13700
71 S E Purnell, J E Ebdon, H D Taylor (2011). Bacteriophage lysis of Enterococcus host strains: A tool for microbial source tracking? Environmental Science & Technology, 45(24): 10699–10705
https://doi.org/10.1021/es202141x
72 B Rémy, S Mion, L Plener, M Elias, E Chabrière, D Daudé (2018). Interference in bacterial quorum sensing: A biopharmaceutical perspective. Frontiers in Pharmacology, 9: 203
https://doi.org/10.3389/fphar.2018.00203
73 Ł Richter, M Janczuk-Richter, J Niedziółka-Jönsson, J Paczesny, R Hołyst (2018). Recent advances in bacteriophage-based methods for bacteria detection. Drug Discovery Today, 23(2): 448–455
https://doi.org/10.1016/j.drudis.2017.11.007
74 S Rodriguez-Mozaz, S Chamorro, E Marti, B Huerta, M Gros, A Sànchez-Melsió, C M Borrego, D Barceló, J L Balcázar (2015). Occurrence of antibiotics and antibiotic resistance genes in hospital and urban wastewaters and their impact on the receiving river. Water Research, 69: 234–242
https://doi.org/10.1016/j.watres.2014.11.021
75 Ş Şener, E Şener, A Davraz (2017). Evaluation of water quality using water quality index (WQI) method and GIS in Aksu River (SW-Turkey). Science of the Total Environment, 584-585: 131–144
https://doi.org/10.1016/j.scitotenv.2017.01.102
76 A N Shkoporov, E V Khokhlova, C B Fitzgerald, S R Stockdale, L A Draper, R P Ross, C Hill (2018). CrAss001 represents the most abundant bacteriophage family in the human gut and infects Bacteroides intestinalis. Nature Communications, 9(1): 4781
https://doi.org/10.1038/s41467-018-07225-7
77 J A Soller, M E Schoen, T Bartrand, J E Ravenscroft, N J Ashbolt (2010). Estimated human health risks from exposure to recreational waters impacted by human and non-human sources of faecal contamination. Water Research, 44(16): 4674–4691
https://doi.org/10.1016/j.watres.2010.06.049
78 E Stachler, C Kelty, M Sivaganesan, X Li, K Bibby, O C Shanks (2017). Quantitative CrAssphage PCR Assays for Human Fecal Pollution Measurement. Environmental Science & Technology, 51(16): 9146–9154
https://doi.org/10.1021/acs.est.7b02703
79 J Q Su, X L An, B Li, Q L Chen, M R Gillings, H Chen, T Zhang, Y G Zhu (2017). Metagenomics of urban sewage identifies an extensively shared antibiotic resistome in China. Microbiome, 5(1): 84
https://doi.org/10.1186/s40168-017-0298-y
80 D Toribio-Avedillo, J Martín-Díaz, J Jofre, A R Blanch, M Muniesa (2019). New approach for the simultaneous detection of somatic coliphages and F-specific RNA coliphages as indicators of fecal pollution. Science of the Total Environment, 655: 263–272
https://doi.org/10.1016/j.scitotenv.2018.11.198
81 M Touchon, J A Moura de Sousa, E P Rocha (2017). Embracing the enemy: the diversification of microbial gene repertoires by phage-mediated horizontal gene transfer. Current Opinion in Microbiology, 38: 66–73
https://doi.org/10.1016/j.mib.2017.04.010
82 Y Turki, H Ouzari, I Mehri, A B Ammar, A Hassen (2012). Evaluation of a cocktail of three bacteriophages for the biocontrol of Salmonella of wastewater. Food Research International, 45(2): 1099–1105
https://doi.org/10.1016/j.foodres.2011.05.041
83 K Vijayavel, M N Byappanahalli, J Ebdon, H Taylor, R Whitman, D Kashian (2014). Enterococcus phages as potential tool for identifying sewage inputs in the Great Lakes region. Journal of Great Lakes Research, 40(4): 989–993
https://doi.org/10.1016/j.jglr.2014.09.011
84 K Vijayavel, R Fujioka, J Ebdon, H Taylor (2010). Isolation and characterization of Bacteroides host strain HB-73 used to detect sewage specific phages in Hawaii. Water Research, 44(12): 3714–3724
https://doi.org/10.1016/j.watres.2010.04.012
85 M Wang, P Liu, Q Zhou, W Tao, Y Sun, Z Zeng (2018). Estimating the contribution of bacteriophage to the dissemination of antibiotic resistance genes in pig feces. Environmental Pollution, 238: 291–298
https://doi.org/10.1016/j.envpol.2018.03.024
86 B Wangkahad, S Mongkolsuk, K Sirikanchana (2017). Integrated multivariate analysis with nondetects for the development of human sewage source-tracking tools using bacteriophages of Enterococcus faecalis. Environmental Science & Technology, 51(4): 2235–2245
https://doi.org/10.1021/acs.est.6b04714
87 Y Wei, A Kirby, B R Levin (2011). The population and evolutionary dynamics of Vibrio cholerae and its bacteriophage: Conditions for maintaining phage-limited communities. American Naturalist, 178(6): 715–725
https://doi.org/10.1086/662677
88 B Wu, R Wang, A G Fane (2017). The roles of bacteriophages in membrane-based water and wastewater treatment processes: A review. Water Research, 110: 120–132
https://doi.org/10.1016/j.watres.2016.12.004
89 Z Wu, J Greaves, L Arp, D Stone, K Bibby (2020). Comparative fate of CrAssphage with culturable and molecular fecal pollution indicators during activated sludge wastewater treatment. Environment International, 136: 105452
https://doi.org/10.1016/j.envint.2019.105452
90 Y Yang, W Shi, S Y Lu, J Liu, H Liang, Y Yang, G Duan, Y Li, H Wang, A Zhang (2018). Prevalence of antibiotic resistance genes in bacteriophage DNA fraction from Funan River water in Sichuan, China. Science of the Total Environment, 626: 835–841
https://doi.org/10.1016/j.scitotenv.2018.01.148
91 Y Yang, X Xie, M Tang, J Liu, H Tuo, J Gu, Y Tang, C Lei, H Wang, A Zhang (2020). Exploring the profile of antimicrobial resistance genes harboring by bacteriophage in chicken feces. Science of the Total Environment, 700: 134446
https://doi.org/10.1016/j.scitotenv.2019.134446
92 M Yen, L S Cairns, A Camilli (2017). A cocktail of three virulent bacteriophages prevents Vibrio cholerae infection in animal models. Nature Communications, 8(1): 14187
https://doi.org/10.1038/ncomms14187
93 Y Yoshida-Takashima, M Yoshida, H Ogata, K Nagasaki, S Hiroishi, T Yoshida (2012). Cyanophage infection in the bloom-forming cyanobacteria Microcystis aeruginosa in surface freshwater. Microbes and Environments, 27(4): 350–355
https://doi.org/10.1264/jsme2.ME12037
94 P Yu, J Mathieu, M Li, Z Dai, P J Alvarez (2016). Isolation of polyvalent bacteriophages by sequential multiple-host approaches. Applied and Environmental Microbiology, 82(3): 808–815
https://doi.org/10.1128/AEM.02382-15
95 P Yu, J Mathieu, G W Lu, N Gabiatti, P J Alvarez (2017). Control of antibiotic-resistant bacteria in activated sludge using polyvalent phages in conjunction with a production host. Environmental Science & Technology Letters, 4(4): 137–142
https://doi.org/10.1021/acs.estlett.7b00045
96 H Yue, Y He, E Fan, L Wang, S Lu, Z Fu (2017). Label-free electrochemiluminescent biosensor for rapid and sensitive detection of pseudomonas aeruginosa using phage as highly specific recognition agent. Biosensors & Bioelectronics, 94: 429–432
https://doi.org/10.1016/j.bios.2017.03.033
97 A Zhang, D R Call, T E Besser, J Liu, L Jones, H Wang, M A Davis (2019).β-lactam resistance genes in bacteriophage and bacterial DNA from wastewater, river water, and irrigation water in Washington State. Water Research, 161: 335–340
https://doi.org/10.1016/j.watres.2019.06.026
98 Y Zhou, A Marar, P Kner, R P Ramasamy (2017). Charge-directed immobilization of bacteriophage on nanostructured electrode for whole-cell electrochemical biosensors. Analytical Chemistry, 89(11): 5734–5741
https://doi.org/10.1021/acs.analchem.6b03751
[1] Xuan Zhu, Chengsong Ye, Yuxin Wang, Lihua Chen, Lin Feng. Assessment of antibiotic resistance genes in dialysis water treatment processes[J]. Front. Environ. Sci. Eng., 2019, 13(3): 45-.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed