Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers in Biology

ISSN 1674-7984

ISSN 1674-7992(Online)

CN 11-5892/Q

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Biol.    2017, Vol. 12 Issue (5) : 361-369    https://doi.org/10.1007/s11515-017-1466-y
RESEARCH ARTICLE
Evaluation of miR-21 and miR-150 expression in immune thrombocytopenic purpura pathogenesis: a case-control study
Elahe Khodadi1, Ali Amin Asnafi1, Javad Mohammadi-Asl2, Seyed Ahmad Hosseini3, Amal Saki Malehi1, Najmaldin Saki1()
1. Thalassemia & Hemoglobinopathy Research center, research institute of health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2. Department of Medical Genetics, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
3. Nutrition and Metabolic Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
 Download: PDF(1575 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

BACKGROUND: Immune thrombocytopenic purpura (ITP) is a common autoimmune disorder diagnosed with thrombocytopenia and bleeding symptoms due to production of autoantibodies (Abs) against platelets. Nowadays, microRNAs are known as novel biomarkers for diagnosis of diseases. The aim of this study was to investigate the expression levels of miR-21 and miR-150 in ITP patients and determine the role of these miRNAs in ITP pathogenesis.

MATERIALS and METHODS:Thirty newly diagnosed patients with acute ITP and 30 healthy subjects( age and sex matched) as controls were enrolled in this study. The expression level of miR-21 and miR-150 was investigated using Real-time-PCR. Comparison of demographic characteristics of the cases was done using independentt-test and chi-square test. Comparison of the expression level of miR-21 and miR-150 with the related parameters was done using independentt-test or Mann–Whitney and Kruskal–Wallis test. Spearman rho correlation coefficient was used to investigate the relationship between the expression of miR-21 and miR-150 with demographic characteristics.

RESULTS: The expression of miR-21, 150 in the patients was not different compared with the control group in general. A significant relationship between the expression of miR-21 with hemoglobin, hematocrit and red blood cell hemoglobin concentration was observed.

DISCUSSION: Expression of miR-21 and miR-150 is not associated with pathogenesis of acute ITP and can involve the synergistic role of other miRNAs. Investigation of miR-21 and miR-150 expression along with other miRNAs and cytokines can be helpful in diagnosis and pathogenesis of ITP.
Keywords immune thrombocytopenic purpura      miR-21      miR-150     
Corresponding Author(s): Najmaldin Saki   
Online First Date: 02 November 2017    Issue Date: 20 November 2017
 Cite this article:   
Elahe Khodadi,Ali Amin Asnafi,Javad Mohammadi-Asl, et al. Evaluation of miR-21 and miR-150 expression in immune thrombocytopenic purpura pathogenesis: a case-control study[J]. Front. Biol., 2017, 12(5): 361-369.
 URL:  
https://academic.hep.com.cn/fib/EN/10.1007/s11515-017-1466-y
https://academic.hep.com.cn/fib/EN/Y2017/V12/I5/361
Fig.1  MiRNAs involved in pathogenesis and Megakaryopoiesis of ITP. MiRNAs can affect immune system to produce antibodies in ITP. Antibodies disturb MKs in BM and this leads to apoptosis of immature and mature MKs as well as thrombocytopenia in ITP patients. Abbreviations: IL, Interleukin; MK, megakaryocyte; CMP, common myeloid progenitor; MEP, MK-erythroid precursor; Ab, antibody; BM, bone marrow; PB, peripheral blood.
Age RBC WBC PLT Hb HCT MCV MCH MCHC Reticulocyte BUN Cr
N=30
Mean 3.7333 4.5007 9.4860 25.4000 9.8660 31.8633 75.5940 22.9190 31.2747 0.5967 11.7000 0.6667
Std. deviation 3.36240 0.85025 3.34521 14.93572 2.07791 4.43143 8.53696 3.33266 2.19811 0.17711 2.25755 0.08442
Tab.1  Demographic characteristics of ITP patients.
Primer sequence Primer length(bp)
miR-21 Forward: 5'- ACGTGTTAGCTTATCAGACTG A-3' 21
Reverse: 5'- GAGCAGGGTCCGAGGT-3' 16
RT: 5'- GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACTCAACA-3' 51
miR-150 Forward: 5'- ACATCTCCCAACCCTTGTAC-3' 18
Reverse: 5'- GAGCAGGGTCCGAGGT-3' 16
RT: 5'-GGTCGTATGCAGAGCAGGGTCCGAGGTATCCATCGCACGCATCGCACTCATACGA
CCCACTGG-3'		 64
Snord 47 Forward: 5'- ATCACTGTAAAACCGTTCA-3' 19
RT: 5'- GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACCACCTC-3' 51
Tab.2  Primersequences of miR-21, 150 and Snord 47
Fig.2  Expression analysis of miR-21 (A) and miR-150 (B) in 30 ITP samples using real-time PCR.
Fig.3  Relative expression levels of miR-21 (A) and miR-150 (B) in 30 ITP samples.
Mir-21 Age RBC WBC PLT Hb HCT MCV MCH MCHC Reticulocyte BUN Cr
DOWN regulation
N=8		 Mean 4.0000 4.9625 8.3750 21.7500 11.5500 34.9750 74.4013 23.4838 32.8025 0.5875 11.1875 0.7125
Std. deviation 2.26779 0.47352 2.27706 8.86002 1.72378 2.96106 7.83233 4.18101 2.33557 0.09910 1.30760 0.08345
ND
N=22		 Mean 3.6364 4.3327 9.8900 26.7273 9.2536 30.7318 76.0277 22.7136 30.7191 0.6000 11.8864 0.6500
Std. deviation 3.72310 0.90154 3.61717 16.58221 1.87054 4.37791 8.91380 3.05697 1.90825 0.20000 2.51629 0.08018
p-value 0.19 0.13 0.13 0.99 0.003 0.021 0.42 0.34 0.045 0.70 0.34 0.11
Tab.3  Demographic characteristics in ITP patients according to miR-21 expression
miR-150 Age RBC WBC PLT Hb HCT MCV MCH MCHC Reticulocyte BUN Cr
DOWN regulation
N=6		 Mean 3.6667 5.1100 8.9667 23.0000 11.3500 34.9167 73.2900 22.3650 32.2767 0.5667 11.0833 0.7333
Std. deviation 1.75119 0.45660 2.18967 4.89898 1.91807 3.36120 8.79344 4.18236 2.42765 0.10328 1.49722 0.08165
ND
N=19		 Mean 3.8947 4.3368 9.1568 27.5789 9.8526 31.4211 76.8989 23.2305 31.1884 0.5632 11.8158 0.6632
Std. deviation 4.10819 0.90387 3.85675 18.12094 1.51010 4.39578 8.32818 3.00683 2.21861 0.08951 2.35237 0.06840
Up regulation
N=5		 Mean 3.2000 4.3920 11.3600 20.0000 8.1360 29.8800 73.4000 22.4000 30.4000 0.7600 12.0000 0.6000
Std. deviation 1.30384 0.77777 1.70088 6.48074 3.06553 4.63325 9.87623 4.08840 1.73638 0.37148 2.91548 0.10000
p-value 0.35 0.14 0.14 0.89 0.08 0.16 0.43 0.97 0.48 0.4 0.37 0.055
Tab.4  Demographic characteristics in ITP patients according to miR-150 expression
Log expression Age RBC WBC PLT Hb HCT MCV MCH MCHC Reticulocyte BUN Cr
Correlation coefficient -0.082 0.042 0.248 -0.203 -0.267 -0.140 -0.323 -0.226 -0.169 0.371 0.147 -0.447
p-value 0.666 0.827 0.187 0.283 0.154 0.461 0.082 0.230 0.371 0.043 0.437 0.013
Tab.5  Correlation between miR-21 expression and demographic characteristics of ITP patients
Log expression Age RBC WBC PLT Hb HCT MCV MCH MCHC Reticulocyte BUN Cr
Correlation coefficient 0.025 0.127 0.124 -0.139 -0.190 -0.052 -0.348 -0.326 -0.290 0.421 0.161 -0.374
p-value 0.897 0.504 0.515 0.465 0.315 0.748 0.059 0.078 0.120 0.020 0.395 0.042
Tab.6  Correlation between miR-150 expression and demographic characteristics of ITP patients
6 Anindo M I, Yaqinuddin  A (2012). Insights into the potential use of microRNAs as biomarker in cancer. Int J Surg, 10(9): 443–449
https://doi.org/10.1016/j.ijsu.2012.08.006 pmid: 22906693
17 Babashah S, Sadeghizadeh  M, Tavirani M R ,  Farivar S ,  Soleimani M  (2012). Aberrant microRNA expression and its implications in the pathogenesis of leukemias. Cell Oncol (Dordr), 35(5): 317–334 
https://doi.org/10.1007/s13402-012-0095-3 pmid: 22956261
14 Bai H, Xu  R, Cao Z ,  Wei D, Wang  C (2011). Involvement of miR-21 in resistance to daunorubicin by regulating PTEN expression in the leukaemia K562 cell line. FEBS Lett, 585(2): 402–408
https://doi.org/10.1016/j.febslet.2010.12.027 pmid: 21187093
9 Bay A, Coskun  E, Oztuzcu S ,  Ergun S ,  Yilmaz F ,  Aktekin E  (2014). Plasma microRNA profiling of pediatric patients with immune thrombocytopenic purpura. Blood Coagul Fibrinolysis, 25(4): 379–383
https://doi.org/10.1097/MBC.0000000000000069 pmid: 24418947
19 Bustin S A, Benes  V, Garson J A ,  Hellemans J ,  Huggett J ,  Kubista M ,  Mueller R ,  Nolan T ,  Pfaffl M W ,  Shipley G L ,  Vandesompele J ,  Wittwer C T  (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem, 55(4): 611–622 
https://doi.org/10.1373/clinchem.2008.112797 pmid: 19246619
13 Dai Y, Huang  Y S, Tang  M, Lv T Y ,  Hu C X ,  Tan Y H ,  Xu Z M ,  Yin Y B  (2007). Microarray analysis of microRNA expression in peripheral blood cells of systemic lupus erythematosus patients. Lupus, 16(12): 939–946 
https://doi.org/10.1177/0961203307084158 pmid: 18042587
8 Edelstein L C ,  Bray P F  (2011). MicroRNAs in platelet production and activation. Blood, 117(20): 5289–5296 
https://doi.org/10.1182/blood-2011-01-292011 pmid: 21364189
26 Edelstein L C ,  Bray P F  (2011). MicroRNAs in platelet production and activation. Blood, 117(20): 5289–5296
https://doi.org/10.1182/blood-2011-01-292011 pmid: 21364189
16 Ghisi M, Corradin  A, Basso K ,  Frasson C ,  Serafin V ,  Mukherjee S ,  Mussolin L ,  Ruggero K ,  Bonanno L ,  Guffanti A ,  De Bellis G ,  Gerosa G ,  Stellin G ,  D’Agostino D M ,  Basso G ,  Bronte V ,  Indraccolo S ,  Amadori A ,  Zanovello P  (2011). Modulation of microRNA expression in human T-cell development: targeting of NOTCH3 by miR-150. Blood, 117(26): 7053–7062 
https://doi.org/10.1182/blood-2010-12-326629 pmid: 21551231
10 Gordon J E, Wong  J J, Rasko  J E (2013). MicroRNAs in myeloid malignancies. Br J Haematol, 162(2): 162–176
https://doi.org/10.1111/bjh.12364 pmid: 23679825
4 Heyns Adu P, Badenhorst  P N, Lötter  M G, Pieters  H, Wessels P ,  Kotzé H F  (1986). Platelet turnover and kinetics in immune thrombocytopenic purpura: results with autologous 111In-labeled platelets and homologous 51Cr-labeled platelets differ. Blood, 67(1): 86–92
pmid: 3940554
28 Hussein K, Theophile  K, Büsche G ,  Schlegelberger B ,  Göhring G ,  Kreipe H ,  Bock O (2010). Significant inverse correlation of microRNA-150/MYB and microRNA-222/p27 in myelodysplastic syndrome. Leuk Res, 34(3): 328–334 
https://doi.org/10.1016/j.leukres.2009.06.014 pmid: 19615744
29 Jernås M, Nookaew  I, Wadenvik H ,  Olsson B  (2013). MicroRNA regulate immunological pathways in T-cells in immune thrombocytopenia (ITP). Blood, 121(11): 2095–2098
https://doi.org/10.1182/blood-2012-12-471250 pmid: 23303824
23 Johnsen J(2012). Pathogenesis in immune thrombocytopenia: new insights. Hematology Am Soc Hematol Educ Program, 2012(1): 306–312
pmid: 23233597
2 Khodadi E, Asnafi  A A, Shahrabi  S, Shahjahani M ,  Saki N (2016). Bone marrow niche in immune thrombocytopenia: a focus on megakaryopoiesis. Ann Hematol, 95(11): 1765–1776
https://doi.org/10.1007/s00277-016-2703-1 pmid: 27236577
1 Ku F C, Tsai  C R, Der Wang  J, Wang C H ,  Chang T K ,  Hwang W L  (2013). Stromal-derived factor-1 gene variations in pediatric patients with primary immune thrombocytopenia. Eur J Haematol, 90(1): 25–30
https://doi.org/10.1111/ejh.12025 pmid: 23078136
15 Li H, Zhao  H, Wang D ,  Yang R (2011). microRNA regulation in megakaryocytopoiesis. Br J Haematol, 155(3): 298–307
https://doi.org/10.1111/j.1365-2141.2011.08859.x pmid: 21910717
25 Machlus K R, Thon  J N, Italiano  J E Jr(2014). Interpreting the developmental dance of the megakaryocyte: a review of the cellular and molecular processes mediating platelet formation. Br J Haematol, 165(2): 227–236
https://doi.org/10.1111/bjh.12758 pmid: 24499183
20 Naderi M, Abdul  T H, Soleimani  M, Shabani I ,  Hashemi S M  (2015). A Home-brew Real-time PCR Assay for Reliable Detection and Quantification of Mature miR-122. Appl Immunohistochem Mol Morphol, 23(8): 601–606
21 Pfaffl M W, Horgan  G W, Dempfle  L (2002). Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res, 30(9): e36
3 Rank A, Weigert  O, Ostermann H  (2010). Management of chronic immune thrombocytopenic purpura: targeting insufficient megakaryopoiesis as a novel therapeutic principle. Biologics, 4: 139–145 
https://doi.org/10.2147/BTT.S3436 pmid: 20531970
18 Rodeghiero F, Stasi  R, Gernsheimer T ,  Michel M ,  Provan D ,  Arnold D M ,  Bussel J B ,  Cines D B ,  Chong B H ,  Cooper N ,  Godeau B ,  Lechner K ,  Mazzucconi M G ,  McMillan R ,  Sanz M A ,  Imbach P ,  Blanchette V ,  Kühne T ,  Ruggeri M ,  George J N  (2009). Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood, 113(11): 2386–2393
https://doi.org/10.1182/blood-2008-07-162503 pmid: 19005182
12 Rossi S, Shimizu  M, Barbarotto E ,  Nicoloso M S ,  Dimitri F ,  Sampath D ,  Fabbri M ,  Lerner S ,  Barron L L ,  Rassenti L Z ,  Jiang L ,  Xiao L, Hu  J, Secchiero P ,  Zauli G ,  Volinia S ,  Negrini M ,  Wierda W ,  Kipps T J ,  Plunkett W ,  Coombes K R ,  Abruzzo L V ,  Keating M J ,  Calin G A  (2010). microRNA fingerprinting of CLL patients with chromosome 17p deletion identify a miR-21 score that stratifies early survival. Blood, 116(6): 945–952
https://doi.org/10.1182/blood-2010-01-263889 pmid: 20393129
22 Saki N, Abroun  S, Soleimani M ,  Mortazavi Y ,  Kaviani S ,  Arefian E  (2014). The roles of miR-146a in the differentiation of Jurkat T-lymphoblasts. Hematology, 19(3): 141–147 
https://doi.org/10.1179/1607845413Y.0000000105 pmid: 23796062
5 Shah P P, Hutchinson  L E, Kakar  S S (2009). Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer. J Ovarian Res, 2(1): 11 
https://doi.org/10.1186/1757-2215-2-11 pmid: 19712461
11 Stasi R (2012). Immune thrombocytopenia: Pathophysiologic and clinical update. Semin Thromb Hemost, 38: 454–462
30 Tavakoli F, Jaseb  K, Jalali Far M A ,  Soleimani M ,  Khodadi E ,  Saki N (2016). Evaluation of MicroRNA-146a expression in acute lymphoblastic Leukemia. Front Biol, 22: 1–6
27 Wang M, Tan  L P, Dijkstra  M K, van Lom  K, Robertus J L ,  Harms G ,  Blokzijl T ,  Kooistra K ,  van T’veer M B ,  Rosati S ,  Visser L ,  Jongen-Lavrencic M ,  Kluin P M ,  van den Berg A  (2008). miRNA analysis in B-cell chronic lymphocytic leukaemia: proliferation centres characterized by low miR-150 and high BIC/miR-155 expression. J Pathol, 215(1): 13–20 
https://doi.org/10.1002/path.2333 pmid: 18348159
24 Zhou B, Zhao  H, Yang R C ,  Han Z C  (2005). Multi-dysfunctional pathophysiology in ITP. Crit Rev Oncol Hematol, 54(2): 107–116 
https://doi.org/10.1016/j.critrevonc.2004.12.004 pmid: 15843093
7 Zhu C, Wang  Y, Kuai W ,  Sun X, Chen  H, Hong Z  (2013). Prognostic value of miR-29a expression in pediatric acute myeloid leukemia. Clin Biochem, 46(1-2): 49–53 
https://doi.org/10.1016/j.clinbiochem.2012.09.002 pmid: 22981932
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed