Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers in Biology

ISSN 1674-7984

ISSN 1674-7992(Online)

CN 11-5892/Q

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front Biol    2010, Vol. 5 Issue (5) : 445-454    https://doi.org/10.1007/s11515-010-0810-2
RESEARCH ARTICLE
Prostaglandin E2 promotes hematopoietic development from human embryonic stem cells
Chao YANG1,2, Jia-Fei XI1, Xiao-Yan XIE1, Wen YUE1, Ruo-Yong WANG1, Qiong WU1, Li-Juan HE1, Xue NAN1, Yan-Hua LI1, Xue-Tao PEI1()
1. Stem Cell and Regenerative Medicine Lab, Beijing Institute of Transfusion Medicine, Beijing 100850, China; 2. 522 Hospital of Chinese PLA, Luoyang 471000, China
 Download: PDF(547 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Recent studies have suggested that prostaglandin (PG) E2 (PGE2) and the prostaglandin pathway are essential for hematopoietic stem cell growth and development. However, similar studies on hematopoietic commitment from human embryonic stem cells (hESCs) are still limited. Here we report that the addition of PGE2 promotes hematopoietic differentiation of hESCs. The induced cells from hESCs/OP9 co-culture and in the presence of PGE2 were characterized by reverse transcription-PCR (RT-PCR), flow cytometry, colony-forming assays and Wright-Giemsa staining. Our results demonstrated that PGE2 exposure could alter the gene expression pattern and morphology of co-cultured hESCs and resulted in a robust hematopoietic differentiation with higher frequencies of CD34+ and CD45+ cells. Furthermore, the Smad signaling pathway may be involved in PGE2 and OP9 induced hematopoietic differentiation of hESCs. This research may improve our knowledge of stem cell regulation and hopefully lead to better stem cell-based therapeutic options.
Keywords human embryonic stem cells      prostaglandin E2      hematopoiesis      in vitro differentiation     
Corresponding Author(s): PEI Xue-Tao,Email:shirlylyh@126.com, peixt@nic.bmi.ac.cn   
Issue Date: 01 October 2010
 Cite this article:   
Chao YANG,Jia-Fei XI,Xiao-Yan XIE, et al. Prostaglandin E2 promotes hematopoietic development from human embryonic stem cells[J]. Front Biol, 2010, 5(5): 445-454.
 URL:  
https://academic.hep.com.cn/fib/EN/10.1007/s11515-010-0810-2
https://academic.hep.com.cn/fib/EN/Y2010/V5/I5/445
gene accession no.product/bpprimer sequence
Oct4 NM_001735311235′AACCTGGAGTTTGTGCCAGGGTTT3′ forward
5′TGAACTTCACCTTCCCTCCAACCA3′ reverse
Brachyury NM_0031813005′ GCGGGAAAGAGCCTGCAGTA3′ forward
5′ TTCCCCGTTCACGTACTTCC3′ reverse
RUNX1 NM_0017541705′ATGTGGTCCTATTTAAGCCAGCCC3′ forward
5′TCATCTGGCTGAAGACACCAGCTT3′ reverse
CD34 NM_0017732015′CCTAAGTGACATCAAGGCAGAA3′ forward
5′GCAAGGAGCAGGGAGCATA3′ reverse
GATA1 NM_0020491975′ TTAGCCACCTCATGCCTTTCCCT3′ forward
5′ CCAGAGACTTGGGTTGTCCAGAAT3′ reverse
SCL NM_0031892595′ TCTCTCGGCAGCGGGTTCTTT3′ forward
5′ CCAGGCGGAGGATCTCATTCTT3′ reverse
γ-Globin NM_0005593705′ CGCTTCTGGAACGTCTGAGGTTAT3′ forward
5′ CCAGGAGCTTGAAGTTCTCAGGAT3′ reverse
Ang1 NM_0011462005′ GGGGGAGGTTGGACTGTAAT3′ forward
5′ GAATAGGCTCGGTTCCCTTC3′ reverse
vWF NM_0005223665′ CCCACCCTTTGATGAACACA3′ forward
5′ CCTCACTTGCTGCACTTCCT3′ reverse
GAPDH NM_0020461105′CTGACTTCAACAGCGACACC3′ forward
5′TGCTGTAGCCAAATTCGTTGT3′ reverse
Tab.1  The primers for RT-PCR
Fig.1  A: Morphology of hESCs; B: Colonies of hES cells were stained for alkaline phosphatase; C: Immunocytochemical analysis of stem cell markers in hES cells (scale bars: 100 μm). Immunocytochemical staining showed that the hES cells exhibited high expression of Oct4, Tra-1-60, and Tra-1-81 (scale bars: 100 μm). D: Expression of cell surface markers SSEA-4, Tra-1-81, CD34 and CD45 was analyzed by flow cytometry.
Fig.1  A: Morphology of hESCs; B: Colonies of hES cells were stained for alkaline phosphatase; C: Immunocytochemical analysis of stem cell markers in hES cells (scale bars: 100 μm). Immunocytochemical staining showed that the hES cells exhibited high expression of Oct4, Tra-1-60, and Tra-1-81 (scale bars: 100 μm). D: Expression of cell surface markers SSEA-4, Tra-1-81, CD34 and CD45 was analyzed by flow cytometry.
Fig.2  A: Number of hematopoietic colonies generated from human embryonic stem cells (hESCs) in different treatment groups. The best effect of prostaglandin E2 (PGE2) showed at 20 ng/mL. Under this circumstance the total number of derived colony forming unit (CFU) colonies was increased by 1.4-fold, as compared with the control colony growth (185±15.3 132±12.9, <0.05). The data represent the mean±SD from three experiments. B: Morphology (left column) and Wright staining of cytospins (right column) of different CFC types in hESC/OP9 co-culture.
Fig.2  A: Number of hematopoietic colonies generated from human embryonic stem cells (hESCs) in different treatment groups. The best effect of prostaglandin E2 (PGE2) showed at 20 ng/mL. Under this circumstance the total number of derived colony forming unit (CFU) colonies was increased by 1.4-fold, as compared with the control colony growth (185±15.3 132±12.9, <0.05). The data represent the mean±SD from three experiments. B: Morphology (left column) and Wright staining of cytospins (right column) of different CFC types in hESC/OP9 co-culture.
Fig.3  A: Clumps of hESCs were seeded on irradiated OP9 with or without prostaglandin E2 (PGE2) and photographed at low magnification after 3 or 9 days. B: Cells seeded as above were counted at various times. Co-culture on OP9 with PGE2 yielded more cells. The data represent the mean±SD from three experiments. Student's -test: *: <0.05, **: <0.01.
Fig.3  A: Clumps of hESCs were seeded on irradiated OP9 with or without prostaglandin E2 (PGE2) and photographed at low magnification after 3 or 9 days. B: Cells seeded as above were counted at various times. Co-culture on OP9 with PGE2 yielded more cells. The data represent the mean±SD from three experiments. Student's -test: *: <0.05, **: <0.01.
Fig.4  A: Gene expression analysis of hematopoiesis-induced transcription factors and hematoendothelial markers by reverse transcription-PCR (RT-PCR). B: Emergence of CD34 and CD45 hematopoietic cells during H9/OP9 co-culture. The data represent the mean±SD from three experiments. Student's -test: **: <0.01.
Fig.4  A: Gene expression analysis of hematopoiesis-induced transcription factors and hematoendothelial markers by reverse transcription-PCR (RT-PCR). B: Emergence of CD34 and CD45 hematopoietic cells during H9/OP9 co-culture. The data represent the mean±SD from three experiments. Student's -test: **: <0.01.
Fig.5  1: H9; 2: without PGE2; 3: with PGE2; 4: Indomethacin. Human embryonic stem cells were co-cultured with OP9 feeder layer for 9 days as previously described, the expression/phosphorylation of Smad1/5 and the expression of Smad4 during the incubation process were detected respectively. Endogenous β-actin expression was set as control. The supplement of PGE2 increased Smad1/5 phosphorylation modestly, while it dramatically improved Smad4 expression. Correlatively, Smad4 level was reduced by the inhibitor of PGE2, indomethacin. The gels shown are representative of three obtained with similar results.
Fig.5  1: H9; 2: without PGE2; 3: with PGE2; 4: Indomethacin. Human embryonic stem cells were co-cultured with OP9 feeder layer for 9 days as previously described, the expression/phosphorylation of Smad1/5 and the expression of Smad4 during the incubation process were detected respectively. Endogenous β-actin expression was set as control. The supplement of PGE2 increased Smad1/5 phosphorylation modestly, while it dramatically improved Smad4 expression. Correlatively, Smad4 level was reduced by the inhibitor of PGE2, indomethacin. The gels shown are representative of three obtained with similar results.
1 Alfranca A, López-Oliva J M, Genós L, López-Maderuelo D, Mirones I, Salvado D, Quesada A J, Arroyo A G, Redondo J M (2008). PGE2 induces angiogenesis via MT1-MMP-mediated activation of the TGFbeta/Alk5 signaling pathway. Blood , 112(4): 1120–1128
doi: 10.1182/blood-2007-09-112268
2 Bhatia M, Bonnet D, Wu D, Murdoch B, Wrana J, Gallacher L, Dick J E (1999). Bone morphogenetic proteins regulate the developmental program of human hematopoietic stem cells. J Exp Med , 189(7): 1139–1148
doi: 10.1084/jem.189.7.1139
3 Bhattacharya B, Miura T, Brandenberger R, Mejido J, Luo Y, Yang A X, Joshi B H, Ginis I, Thies R S, Amit M, Lyons I, Condie B G, Itskovitz-Eldor J, Rao M S, Puri R K (2004). Gene expression in human embryonic stem cell lines: unique molecular signature. Blood , 103(8): 2956–2964
doi: 10.1182/blood-2003-09-3314
4 Cha Y I, Kim S H, Solnica-Krezel L, Dubois R N (2005). Cyclooxygenase-1 signaling is required for vascular tube formation during development. Dev Biol , 282(1): 274–283
doi: 10.1016/j.ydbio.2005.03.014
5 Chadwick K, Wang L, Li L, Menendez P, Murdoch B, Rouleau A, Bhatia M (2003). Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells. Blood , 102(3): 906–915
doi: 10.1182/blood-2003-03-0832
6 Choi J H, Ryu Y S, Kim K H, Lee Y R, Cha K W, Han I S, Kwon B S (2009). In vitro development of a hemangioblast from a human embryonic stem cell, SNUhES#3. Life Sci , 85(1-2): 39–45
7 Frisch B J, Porter R L, Gigliotti B J, Olm-Shipman A J, Weber J M, O’Keefe R J, Jordan C T, Calvi L M (2009). In vivo prostaglandin E2 treatment alters the bone marrow microenvironment and preferentially expands short-term hematopoietic stem cells. Blood , 114(19): 4054–4063
doi: 10.1182/blood-2009-03-205823
8 Gentile P S, Pelus L M (1987). In vivo modulation of myelopoiesis by prostaglandin E2. II. Inhibition of granulocyte-monocyte progenitor cell (CFU-GM) cell-cycle rate. Exp Hematol , 15(2): 119–126
9 Goessling W, North T E, Loewer S, Lord A M, Lee S, Stoick-Cooper C L, Weidinger G, Puder M, Daley G Q, Moon R T, Zon L I (2009). Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell , 136(6): 1136–1147
10 Hirashima M, Kataoka H, Nishikawa S, Matsuyoshi N, Nishikawa S I (1999). Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood , 93(4): 1253–1263
11 Hoggatt J, Singh P, Sampath J, Pelus L M (2009). Prostaglandin E2 enhances hematopoietic stem cell homing, survival, and proliferation. Blood , 113(22): 5444–5455
doi: 10.1182/blood-2009-01-201335
12 Ji J, Vijayaragavan K, Bosse M, Menendez P, Weisel K, Bhatia M (2008). OP9 stroma augments survival of hematopoietic precursors and progenitors during hematopoietic differentiation from human embryonic stem cells. Stem Cells , 26(10): 2485–2495
doi: 10.1634/stemcells.2008-0642
13 Larsson J, Karlsson S (2005). The role of Smad signaling in hematopoiesis. Oncogene , 24(37): 5676–5692
doi: 10.1038/sj.onc.1208920
14 Leahy K M, Koki A T, Masferrer J L (2000). Role of cyclooxygenases in angiogenesis. Curr Med Chem , 7: 1163–1170
15 Letamendia A, Labbé E, Attisano L (2001). Transcriptional regulation by Smads: crosstalk between the TGF-beta and Wnt pathways. J Bone Joint Surg Am , 83-A(Pt 1 Suppl 1): S31–S39
16 Liou J Y, Ellent D P, Lee S, Goldsby J, Ko B S, Matijevic N, Huang J C, Wu K K (2007). Cyclooxygenase-2-derived prostaglandin e2 protects mouse embryonic stem cells from apoptosis. Stem Cells , 25(5): 1096–1103
doi: 10.1634/stemcells.2006-0505
17 Liu Y X, Ji L, Yue W, Yan Z F, Wang J, Xi J F, Zhang R, Nan X, Bai C X, Chen L, Wang Y F, Pei X T (2009). Cells extract from fetal liver promotes the hematopoietic differentiation of human embryonic stem cells. Cloning Stem Cells , 11(1): 51–60
doi: 10.1089/clo.2008.0049
18 Liu Z, Tang Y, Qiu T, Cao X, Clemens T L (2006). A dishevelled-1/Smad1 interaction couples WNT and bone morphogenetic protein signaling pathways in uncommitted bone marrow stromal cells. J Biol Chem , 281(25): 17156–17163
doi: 10.1074/jbc.M513812200
19 Lu L, Pelus L M, Broxmeyer H E (1984). Modulation of the expression of HLA-DR (Ia) antigens and the proliferation of human erythroid (BFU-E) and multipotential (CFU-GEMM) progenitor cells by prostaglandin E. Exp Hematol , 12(9): 741–748
20 Lu S J, Feng Q, Park J S, Vida L, Lee B S, Strausbauch M, Wettstein P J, Honig G R, Lanza R (2008). Biological properties and enucleation of red blood cells from human embryonic stem cells. Blood , 112: 4475–4484
doi: 10.1182/blood-2008-05-157198
21 Lu S J, Li F, Vida L, Honig G R (2004). CD34+CD38- hematopoietic precursors derived from human embryonic stem cells exhibit an embryonic gene expression pattern. Blood , 103(11): 4134–4141
doi: 10.1182/blood-2003-10-3575
22 Ma F, Ebihara Y, Umeda K, Sakai H, Hanada S, Zhang H, Zaike Y, Tsuchida E, Nakahata T, Nakauchi H, Tsuji K (2008). Generation of functional erythrocytes from human embryonic stem cell-derived definitive hematopoiesis. Proc Natl Acad Sci U S A , 105(35): 13087–13092
doi: 10.1073/pnas.0802220105
23 Miller S B (2006). Prostaglandins in health and disease: an overview. Semin Arthritis Rheum , 36(1): 37–49
doi: 10.1016/j.semarthrit.2006.03.005
24 Naito A T, Shiojima I, Akazawa H, Hidaka K, Morisaki T, Kikuchi A, Komuro I (2006). Developmental stage-specific biphasic roles of Wnt/β-catenin signaling in cardiomyogenesis and hematopoiesis. Proc Natl Acad Sci U S A , 103(52): 19812–19817
doi: 10.1073/pnas.0605768103
25 North T E, Goessling W, Walkley C R, Lengerke C, Kopani K R, Lord A M, Weber G J, BowmanT V, Jang I H, Grosser T, Fitzgerald G A, Daley G Q, Orkin S H, Zon L I (2007). Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature , 447(7147): 1007–1011
doi: 10.1038/nature05883
26 Smith W L, DeWitt D L, Garavito R M (2000). Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem , 69: 145–182
doi: 10.1146/annurev.biochem.69.1.145
27 Srivastava A S, Nedelcu E, Esmaeli-AzadB, Mishra R, Carrier E (2007). Thrombopoietin enhances generation of CD34+ cells from human embryonic stem cells. Stem Cells , 25(6): 1456–1461
doi: 10.1634/stemcells.2006-0701
28 Varga A C, Wrana J L (2005). The disparate role of BMP in stem cell biology. Oncogene , 24(37): 5713–5721
doi: 10.1038/sj.onc.1208919
29 Vodyanik M A, Bork J A, Thomson J A, Slukvin I I (2005). Human embryonic stem cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of lymphohematopoietic potential. Blood , 105(2): 617–626
doi: 10.1182/blood-2004-04-1649
31 WangL, Li L, Menendez P, Cerdan C, Bhatia M (2005). Human embryonic stem cells maintained in the absence of mouse embryonic fibroblasts or conditioned media are capable of hematopoietic development. Blood , 105(12): 4598–4603
doi: 10.1182/blood-2004-10-4065
32 Zhang P, Li J, Tan Z, Wang C, Liu T, Chen L, Yong J, Jiang W, Sun X, Du L, Ding M, Deng H (2008). Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells. Blood , 111(4): 1933–1941
doi: 10.1182/blood-2007-02-074120
[1] Massimo Bonora,Paolo Pinton,Keisuke Ito. Mitochondrial control of hematopoietic stem cell balance and hematopoiesis[J]. Front. Biol., 2015, 10(2): 117-124.
[2] Weiqiang LI, Jie QIN, Xinyu LI, Li ZHANG, Chang LIU, Fei CHEN, Zifei WANG, Lirong ZHANG, Xiuming ZHANG, Bruce T. LAHN, Andy Peng XIANG. A versatile tool for tracking the differentiation of human embryonic stem cells[J]. Front Biol, 2010, 5(5): 455-463.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed