Please wait a minute...
Frontiers of Medicine

ISSN 2095-0217

ISSN 2095-0225(Online)

CN 11-5983/R

Postal Subscription Code 80-967

2018 Impact Factor: 1.847

Front. Med.    2017, Vol. 11 Issue (1) : 137-146     DOI: 10.1007/s11684-016-0486-3
RESEARCH ARTICLE |
Effects of different doses of cadmium on secondary metabolites and gene expression in Artemisia annua L.
Liangyun Zhou1,Guang Yang1,Haifeng Sun2,Jinfu Tang1,Jian Yang1,Yizhan Wang3,Thomas Avery Garran1,Lanping Guo1()
1. The State Key Laboratory Breeding Base of Dao-di Herbs, National Resource Center for Chinese Materia Medica, China Academy of Chinese Medical Sciences, Beijing 100700, China
2. College of Chemistry and Chemical Engineering, Shanxi University, Taiyuan 030006, China
3. Eye Hospital, China Academy of Chinese Medical Sciences, Beijing 100523, China
Download: PDF(453 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract  

This study aims to elucidate the underlying molecular mechanisms of artemisinin accumulation induced by cadmium (Cd). The effects of different Cd concentrations (0, 20, 60, and 120 μmol/L) on the biosynthesis of Artemisia annua L. were examined. Intermediate and end products were quantified by HPLC-ESI-MS/MS analysis. The expression of key biosynthesis enzymes was also determined by qRT-PCR. The results showed that the application of treatment with 60 and 120 μmol/L Cd for 3 days significantly improved the biosynthesis of artemisinic acid, arteannuin B, and artemisinin. The concentrations of artemisinic acid, arteannuin B, and artemisinin in the 120 μmol/L Cd-treated group were 2.26, 102.08, and 33.63 times higher than those in the control group, respectively. The concentrations of arteannuin B and artemisinin in 60 μmol/L Cd-treated leaves were 61.10 and 26.40 times higher than those in the control group, respectively. The relative expression levels of HMGR, FPS, ADS, CYP71AV1, DBR2, ALDH1, and DXR were up-regulated in the 120 μmol/L Cd-treated group because of increased contents of artemisinic metabolites after 3 days of treatment. Hence, appropriate doses of Cd can increase the concentrations of artemisinic metabolites at a certain time point by up-regulating the relative expression levels of key enzyme genes involved in artemisinin biosynthesis.

Keywords Cd      secondary metabolites      gene expressions      Artemisia annua L.     
Corresponding Authors: Lanping Guo   
Just Accepted Date: 14 November 2016   Online First Date: 08 December 2016    Issue Date: 20 March 2017
URL:  
http://academic.hep.com.cn/fmd/EN/10.1007/s11684-016-0486-3     OR     http://academic.hep.com.cn/fmd/EN/Y2017/V11/I1/137
Fig.1  Possible pathways of artemisinin biosynthesis in A. annua (AA, artemisinic acid; AB, arteannuin B; DHAA, dihydroartemisinic acid; and AN, artemisinin).
Analytes MRM transitions (m/z) Fragmentor (V) Collision energy (eV)
AA 235 → 200 150 10
AB 249 → 189 100 5
DHAA 237 → 200 150 10
AN 283 → 247 100 5
Tab.1  Analysis of MS parameters of the four compounds
Gene ID Forward Primer Sequence (5′ to 3′) /
Reverse Primer Sequence (5′ to 3′)
Product size (bp)
Actin (EU531837) CCAGGCTGTTCAGTCTCTGTAT
CGCTCGGTAAGGATCTTCATCA
180
HMGR (AF142473) GTAAACTGCCACCCAAACCA
AGTAAGCGACTGAGAAGAATAAGG
159
FPS (GQ420346) ATACCTGGAGGAAAGCTGAACC
CAACCAAGGGCAGATGAAAG
110
ADS (JQ319661) CGAATGGGCTGTCTCTGC
CTTCATATAACTTTCAAGGCTCG
133
CYP71AV1 (DQ453967) CGAGACTTTAACTGGTGAGATTGT
CGAAGCGACTGAAATGACTTTACT
144
ALDH1(FJ809784) ATGGACTTGCCTCAGGTGTAT
TGCCTCTAATCCTTGTTCTCG
170
DBR2 (EU704257) GCGGTGGTTACACTAGAGAACTT
ATAATCAAAACTAGAGGAGTGACCC
228
DXS (AF182286) GTGCTTCCAGACCGTTACATTGA
AGCCTCTCGTGTTTGCCCAAGGT
120
DXR (AF182287) GGTGATGAAGGTGTTGTTGAGGTT
AGGGACCGCCAGCAATTAAGGT
160
Tab.2  Nucleotide sequences of primers used in real-time PCR
Fig.2  Effects of different doses of Cd on AA (A), AB (B), DHAA (C), and AN (D) in A. annua. Vertical bars represent the srandard error (SE) n = 3. Asterisks represent significant differences between treated and control A. annua plants at the same time (*P<0.05, **P<0.01).
Fig.3  Changes in the relative expression levels (A and C) of HMGR and FPS after Cd treatment and the ratio of relative expression between treated and control A. annua plants at the same time (B and D). The error bars represent the standard error (SE), n = 3.
Fig.4  Changes in the relative expression levels of ADS and CYP71AV1 (A and C) and the ratio of relative expression between treated and control A. annua plants at the same time (B and D) after Cd treatment. The error bars represent the standard error (SE), n = 3.
Fig.5  Changes in the relative expression levels (A and C) of DBR2 and ALDH1 and the ratio of relative expression between treated and control A. annua plants at the same time (B and D) after Cd treatment. The error bars represent the standard error (SE), n = 3.
Fig.6  Changes in the relative expression levels (A and C) of DXS and DXR and the ratio of relative expression between the treated and control A. annua plants at the same time (B and D) after Cd treatment. The error bars represent the standard error (SE), n = 3.
1 Dixon RA. Natural products and plant disease resistance. Nature 2001; 411(6839): 843–847
doi: 10.1038/35081178 pmid: 11459067
2 Wink M. Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry 2003; 64(1): 3–19
doi: 10.1016/S0031-9422(03)00300-5 pmid: 12946402
3 Huang CY, Bazzaz FA, Vanderhoef LN. The inhibition of soybean metabolism by cadmium and lead. Plant Physiol 1974; 54(1): 122–124
doi: 10.1104/pp.54.1.122 pmid: 16658826
4 Larbi A, Morales F, Abadía A, Gogorcena Y, Lucena JJ, Abadía J. Effects of Cd and Pb in sugar beet plants grown in nutrient solution: induced Fe deficiency and growth inhibition. Funct Plant Biol 2002; 29(12): 1453–1464
doi: 10.1071/FP02090
5 Ekmekçi Y, Tanyolaç D, Ayhan B. Effects of cadmium on antioxidant enzyme and photosynthetic activities in leaves of two maize cultivars. J Plant Physiol 2008; 165(6): 600–611
doi: 10.1016/j.jplph.2007.01.017 pmid: 17728009
6 Uraguchi S, Watanabe I, Yoshitomi A, Kiyono M, Kuno K. Characteristics of cadmium accumulation and tolerance in novel Cd-accumulating crops, Avena strigosa and Crotalaria juncea. J Exp Bot 2006; 57(12): 2955–2965
doi: 10.1093/jxb/erl056 pmid: 16873452
7 Shi GX, Xu QS, Xie KB, Xu N, Zhang XL, Zeng XM, Zhou HW, Zhu L. Physiology and ultrastructure of Azolla imbricata as affected by Hg2+ and Cd2+ toxicity. Acta Botanica Sinica (Zhi Wu Xue Bao) 2003; 45: 437–444 (in Chinese)
8 Vitti A, Nuzzaci M, Scopa A, Tataranni G, Remans T, Vangronsveld J, Sofo A. Auxin and cytokinin metabolism and root morphological modifications in Arabidopsis thaliana seedlings infected with Cucumber mosaic virus (CMV) or exposed to cadmium. Int J Mol Sci 2013; 14(4): 6889–6902
doi: 10.3390/ijms14046889 pmid: 23531542
9 Daud MK, Ali S, Variath MT, Zhu SJ. Differential physiological, ultramorphological and metabolic responses of cotton cultivars under cadmium stress. Chemosphere 2013; 93(10): 2593–2602
doi: 10.1016/j.chemosphere.2013.09.082 pmid: 24344393
10 Li X, Zhao M, Guo L, Huang L. Effect of cadmium on photosynthetic pigments, lipid peroxidation, antioxidants, and artemisinin in hydroponically grown Artemisia annua. J Environ Sci (China) 2012; 24(8): 1511–1518
doi: 10.1016/S1001-0742(11)60920-0 pmid: 23513695
11 Zheng Z, Wu M. Cadmium treatment enhances the production of alkaloid secondary metabolites in Catharanthus roseus. Plant Sci 2004; 166(2): 507–514
doi: 10.1016/j.plantsci.2003.10.022
12 Liu D, Zhang L, Li C, Yang K, Wang Y, Sun X, Tang K. Effect of wounding on gene expression involved in artemisinin biosynthesis and artemisinin production in Artemisia annua. Russ J Plant Physiol 2010; 57(6): 882–886
doi: 10.1134/S102144371006018X
13 Yadav RK, Sangwan RS, Sabir F, Srivastava AK, Sangwan NS. Effect of prolonged water stress on specialized secondary metabolites, peltate glandular trichomes, and pathway gene expression in Artemisia annua L. Plant Physiol Biochem 2014; 74: 70–83
doi: 10.1016/j.plaphy.2013.10.023 pmid: 24269871
14 Lei CY, Ma DM, Pu GB, Qi XF, Du ZG, Wang H, Li GF, Ye HC, Liu BY. Foliar application of chitosan activates artemisinin biosynthesis in Artemisia annua L. Ind Crops Prod 2011; 33(1): 176–182
doi: 10.1016/j.indcrop.2010.10.001
15 Arsenault PR, Vail DR, Wobbe KK, Weathers PJ. Effect of sugars on artemisinin production in Artemisia annua L.: transcription and metabolite measurements. Molecules 2010; 15(4): 2302–2318
doi: 10.3390/molecules15042302 pmid: 20428043
16 Pu GB, Ma DM, Chen JL, Ma LQ, Wang H, Li GF, Ye HC, Liu BY. Salicylic acid activates artemisinin biosynthesis in Artemisia annua L. Plant Cell Rep 2009; 28(7): 1127–1135
doi: 10.1007/s00299-009-0713-3 pmid: 19521701
17 Caretto S, Quarta A, Durante M, Nisi R, De Paolis A, Blando F, Mita G. Methyl jasmonate and miconazole differently affect arteminisin production and gene expression in Artemisia annua suspension cultures. Plant Biol (Stuttg) 2011; 13(1): 51–58
doi: 10.1111/j.1438-8677.2009.00306.x pmid: 21143725
18 Duke SO, Paul RN. Development and fine structure of the glandular trichomes of Artemisia annua L. Int J Plant Sci 1993; 154(1): 107–118
doi: 10.1086/297096
19 Akhila A, Thakur RS, Popli SP. Biosynthesis of artemisinin in Artemisia annua. Phytochemistry 1987; 26(7): 1927–1930
doi: 10.1016/S0031-9422(00)81731-8
20 Towler MJ, Weathers PJ. Evidence of artemisinin production from IPP stemming from both the mevalonate and the nonmevalonate pathways. Plant Cell Rep 2007; 26(12): 2129–2136
doi: 10.1007/s00299-007-0420-x pmid: 17710406
21 Bouwmeester HJ, Wallaart TE, Janssen MH, van Loo B, Jansen BJ, Posthumus MA, Schmidt CO, De Kraker JW, König WA, Franssen MC. Amorpha-4,11-diene synthase catalyses the first probable step in artemisinin biosynthesis. Phytochemistry 1999; 52(5): 843–854
doi: 10.1016/S0031-9422(99)00206-X pmid: 10626375
22 Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM, Ho KA, Eachus RA, Ham TS, Kirby J, Chang MC, Withers ST, Shiba Y, Sarpong R, Keasling JD. Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 2006; 440(7086): 940–943
doi: 10.1038/nature04640 pmid: 16612385
23 Teoh KH, Polichuk DR, Reed DW, Nowak G, Covello PS. Artemisia annua L. (Asteraceae) trichome-specific cDNAs reveal CYP71AV1, a cytochrome P450 with a key role in the biosynthesis of the antimalarial sesquiterpene lactone artemisinin. FEBS Lett 2006; 580(5): 1411–1416
doi: 10.1016/j.febslet.2006.01.065 pmid: 16458889
24 Zhang Y, Teoh KH, Reed DW, Maes L, Goossens A, Olson DJ, Ross AR, Covello PS. The molecular cloning of artemisinic aldehyde D11(13) reductase and its role in glandular trichome-dependent biosynthesis of artemisinin in Artemisia annua. J Biol Chem 2008; 283(31): 21501–21508
doi: 10.1074/jbc.M803090200 pmid: 18495659
25 Teoh KH, Polichuk DR, Reed DW, Covello PS. Molecular cloning of an aldehyde dehydrogenase implicated in artemisinin biosynthesis in Artemisia annua. Botany 2009; 87(6): 635–642
doi: 10.1139/B09-032
26 Wallaart TE, Bouwmeester HJ, Hille J, Poppinga L, Maijers NC. Amorpha-4,11-diene synthase: cloning and functional expression of a key enzyme in the biosynthetic pathway of the novel antimalarial drug artemisinin. Planta 2001; 212(3): 460–465
doi: 10.1007/s004250000428 pmid: 11289612
27 Wallaart TE, Lubberink HG, Woerdenbag HJ, Pras N, Quax WJ, Quax WJ. Isolation and identification of dihydroartemisinic acid from Artemisia annua and its possible role in the biosynthesis of artemisinin. J Nat Prod 1999; 62(3): 430–433
doi: 10.1021/np980370p pmid: 10096851
28 Han XL, Huang LQ, Guo LP, Li MJ, Liu XH, Zhang XB. Accumulation and translocation of cadmium in soil and plant and its effects on growth of Artemisia annua and artemisinin content. China J Chin Materia Medica (Zhongguo Zhong Yao Za Zhi) 2010; 35(13): 1655–1659 (in Chinese)
29 Jessing KK, Juhler RK, Strobel BW. Monitoring of artemisinin, dihydroartemisinin, and artemether in environmental matrices using high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). J Agric Food Chem 2011; 59(21): 11735–11743
doi: 10.1021/jf2027632 pmid: 21961706
30 Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008; 3(6): 1101–1108
doi: 10.1038/nprot.2008.73 pmid: 18546601
31 Cheng Q, Su P, Hu Y, He Y, Gao W, Huang L. RNA interference-mediated repression of SmCPS (copalyldiphosphate synthase) expression in hairy roots of Salvia miltiorrhiza causes a decrease of tanshinones and sheds light on the functional role of SmCPS. Biotechnol Lett 2014; 36(2): 363–369
doi: 10.1007/s10529-013-1358-4 pmid: 24078134
32 Gu XC, Chen JF, Xiao Y, Di P, Xuan HJ, Zhou X, Zhang L, Chen WS. Overexpression of allene oxide cyclase promoted tanshinone/phenolic acid production in Salvia miltiorrhiza. Plant Cell Rep 2012; 31(12): 2247–2259
doi: 10.1007/s00299-012-1334-9 pmid: 22926031
33 Shen Q, Chen YF, Wang T, Wu SY, Lu X, Zhang L, Zhang FY, Jiang WM, Wang GF, Tang KX. Overexpression of the cytochrome P450 monooxygenase (cyp71av1) and cytochrome P450 reductase (cpr) genes increased artemisinin content in Artemisia annua (Asteraceae). Genet Mol Res 2012; 11(3): 3298–3309
doi: 10.4238/2012.September.12.13 pmid: 23079824
34 Xiang L, Zeng LX, Yuan Y, Chen M, Wang F, Liu XQ, Zeng LJ, Lan XZ, Liao ZH. Enhancement of artemisinin biosynthesis by overexpressing dxr, cyp71av1 and cpr in the plants of Artemisia annua L. Plant Omics 2012; 5: 503–507
35 Wang HH, Ma CF, Li ZQ, Ma LQ, Wang H, Ye HC, Xu GW, Liu BY. Effects of exogenous methyl jasmonate on artemisinin biosynthesis and secondary metabolites in Artemisia annua L. Ind Crops Prod 2010; 31(2): 214–218
doi: 10.1016/j.indcrop.2009.10.008
36 Wang H, Ma C, Ma L, Du Z, Wang H, Ye H, Li G, Liu B, Xu G. Secondary metabolic profiling and artemisinin biosynthesis of two genotypes of Artemisia annua. Planta Med 2009; 75(15): 1625–1633
doi: 10.1055/s-0029-1185814 pmid: 19548188
[1] Sushun Liu,Qing Pang,Jingyao Zhang,Mimi Zhai,Sinan Liu,Chang Liu. Machine perfusion versus cold storage of livers: a meta-analysis[J]. Front. Med., 2016, 10(4): 451-464.
[2] Xiaoling Wang,Yun Tan,Yizhen Li,Jingming Li,Wen Jin,Kankan Wang. Repression of CDKN2C caused by PML/RARα binding promotes the proliferation and differentiation block in acute promyelocytic leukemia[J]. Front. Med., 2016, 10(4): 420-429.
[3] Jiangnan Liu,Bin Yi,Zhe Zhang,Yi Cao. CD176 single-chain variable antibody fragment inhibits the adhesion of cancer cells to endothelial cells and hepatocytes[J]. Front. Med., 2016, 10(2): 204-211.
[4] Amma Owusu-Ansah,Sung Hee Choi,Agne Petrosiute,John J. Letterio,Alex Yee-Chen Huang. Triterpenoid inducers of Nrf2 signaling as potential therapeutic agents in sickle cell disease: a review[J]. Front. Med., 2015, 9(1): 46-56.
[5] Jian Wang,Biyan Liang,Xiaoping Zhang,Liran Xu,Xin Deng,Xiuhui Li,Lu Fang,Xinghua Tan,Yuxiang Mao,Guoliang Zhang,Yuguang Wang. An 84-month observational study of the changes in CD4 T-lymphocyte cell count of 110 HIV/AIDS patients treated with traditional Chinese medicine[J]. Front. Med., 2014, 8(3): 362-367.
[6] Megan A. Hatlen, Lan Wang, Stephen D. Nimer. AML1-ETO driven acute leukemia: insights into pathogenesis and potential therapeutic approaches[J]. Front Med, 2012, 6(3): 248-262.
[7] Jianguo LIU, Zhe ZHANG, Jiechang GAO, Jiwen XIE, Lin YANG, Shenjun HU. Downregulation effects of beta-elemene on the levels of plasma endotoxin, serum TNF-alpha, and hepatic CD14 expression in rats with liver fibrosis[J]. Front Med, 2011, 5(1): 101-105.
[8] Rui ZHU MD , Lin SHEN MD , Jianguo LIU MD , Weili ZHANG MM , Ling YANG MD , . Effect of decoction on CD14 expression in lipopolysaccharide signal transduction pathway of alcohol-induced liver disease in rats[J]. Front. Med., 2009, 3(3): 363-367.
[9] Xiaohua PAN, Shuhua YANG, Deming XIAO, Yong DAI, Lili REN. Gene expression disparity in giant cell tumor of bone[J]. Front Med Chin, 2009, 3(1): 49-56.
[10] Jianwen REN, Zhenhui PENG, Birong GUO, Min PAN. Celecoxib in combination with retinoid CD437 inhibits melanoma A375 cell in vitro[J]. Front Med Chin, 2009, 3(1): 108-112.
[11] QU Yanchun, YANG Ze, SUN Liang, JI Linong. 662 A/G gene variation in human tumor necrosis factor receptor superfamily, member 9 (TNFRSF9)[J]. Front. Med., 2008, 2(3): 283-285.
[12] SHA Yugen, HUANG Songming, ZHANG Aihua, ZHAO Fei, CHEN Ronghua. Effects of podocin transfection on CD2AP distribution in HEK293 cells[J]. Front. Med., 2008, 2(1): 35-38.
[13] LU Ling, ZHANG Feng, PU Liyong, YAO Aihua, YU Yue, SUN Beicheng, LI Guoqiang, WANG Xuehao. Biological features of intrahepatic CD4+CD25+ T cells in the naturally tolerance of rat liver transplantation[J]. Front. Med., 2007, 1(4): 373-376.
[14] BAI Xiangyang, TANG Duozhuang, ZHU Tao, SUN Lishi, YAN Lingling, LU Yunping, ZHOU Jianfeng, MA Ding. Expression and bioinformatic analysis of lymphoma-associated novel gene KIAA0372[J]. Front. Med., 2007, 1(1): 93-98.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed