Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk

doi:10.15302/J-FASE-2018211

Front. Agr. Sci. Eng.

2018, Vol. 5

Issue (3) : 382-389 https://doi.org/10.15302/J-FASE-2018211

RESEARCH ARTICLE

Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk

Shen LIU¹, Shengzhe SHANG², Xuezhen YANG¹, Huihua ZHANG¹, Dan LU^2,³(

), Ning LI²(

)

¹. School of Life Science and Engineering, Foshan University, Foshan 528000, China
². State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100193, China
³. Shanghai Institute of Medical Genetics, Shanghai Children’s Hospital, Shanghai Jiao Tong University, Shanghai 200040, China

Download: PDF(844 KB) HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks

Abstract

The mammary gland provides a novel method for producing recombinant proteins in milk of transgenic animals. A key component in the technology is the construction of an efficient milk expression vector. Here, we established a simple method to construct a milk expression vector, by a combination of homologous recombination and digestion-ligation. Our methodology is expected to have the advantages of both plasmid and bacterial artificial chromosome (BAC) vectors. The BAC of mouse whey acidic protein gene (mWAP) was modified twice by homologous recombination to produce a universal expression vector, and the human lysozyme gene (hLZ) was then inserted into the vector by a digestion-ligation method. The final vector containing the 8.5 kb mWAP 5′ promoter, 4.8 kb hLZ genomic DNA, and 8.0 kb mWAP 3′ genomic DNA was microinjected into pronuclei of fertilized mouse embryos, to successfully generate two transgenic mouse lines that expressed recombinant human lysozyme (rhLZ) in milk. The highest expression level of rhLZ was 0.45 g·L⁻¹, and rhLZ exhibited the same antibacterial activity as native hLZ. Our results have provided a simple approach to construct a universal milk expression vector, and demonstrated that the resulting vector regulates the expression of hLZ in milk.

Keywords BAC recombinant methods gene expression human lysozyme transgenic mice milk expression vector

Corresponding Author(s): Dan LU,Ning LI

Just Accepted Date: 20 March 2018 Online First Date: 23 April 2018 Issue Date: 31 July 2018

Cite this article:

Shen LIU,Shengzhe SHANG,Xuezhen YANG, et al. Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk[J]. Front. Agr. Sci. Eng. , 2018, 5(3): 382-389.

URL:

https://academic.hep.com.cn/fase/EN/10.15302/J-FASE-2018211
https://academic.hep.com.cn/fase/EN/Y2018/V5/I3/382

Primer	Primer sequence	Utility
PBR-F	5′–CACTAAGAATTTTATACATTCTCAGCTGGCTGTGGTGGTATGTCCACCACTGCAACCCTTcgatcgGATACGCGAGCGAACGTGA–3′	PCR amplification of the origin of replication (ori) and ampicillin resistance gene from pBR322 plasmid for subcloning (2763 bp)
PBR-R	5′–ACTACTTCACAACTATAATTTTGCTACTGTTGGTACTTTCAGGTTGCTGACATCAGATAATTCTTAGACGTCAGGTGGCAC–3′
Zeo-F	5′–ATGCATCCCAGACACTCAGACAGCCATCAGTCACTTGCCTGACACCGGTACCgcggccgcCAGACATGATAAGATACATTGATG–3′	PCR amplification of zeocin resistance gene from pBudCE4.1 plasmid (786 bp)
Zeo-R	5′–TAGACTTGGGCTGGTCACTCCCGACAGGCAGGGATGCCAGGGCCGGCTGCgcggccgcAGTGAGGAGGCTTTTTTGG–3′
ghLZ-F	5′–AATgcggccgcATGAAGGCTCTCATTGTTCTG–3′	PCR amplification of human lysozyme gene (4.8 kb) with two NotI restriction sites
ghLZ-R	5′–AATgcggccgcTTACACTCCACAACCTTGAAC –3′
mWAP- -atg-F	5′–AC CCTTGGCACAGTATGG–3′	The PCR product is 932 bp+ gene length (WAP is 3.0 kb, Zeo is 1.0 kb, and hLZ is 5.4 kb
mWAP-taa-R	5′–ATGGAGTTTGGCTGTA GCTC–3′
P1-F	5′–GATCCACAGGACGGGTGT–3′	PCR detection of transgenic founders (538 bp)
P1-R	5′–CTCCAGCCCACTATTTAGACA–3′	PCR detection of transgenic founders (538 bp)
P2-F	5′–CCGAGTGAATAAATTAGACA–3′	PCR detection of transgenic founders (568 bp)
P2-R	5′–ACGGAAATGTTGAATACTCAT–3′	PCR detection of transgenic founders (568 bp)
hLZ-F	5′–TTATACACACGGCTTTAC–3′	Primers for PCR detection and DIG-labeled probe synthesis (637 bp)
hLZ-R	5′–CAGCATCAGCGATGTTATCT–3′
Exon1-2-F	5′–ATCAGCCTAGCAAACTGGAT–3′	RT-PCR for hLZ (322 bp)
Exon4-R	5′–CTCCACAACCTTGAACATAC–3′	RT-PCR for hLZ (322 bp)
GAPDH-F	5′–AGGCCGGTGCTGAGTATGTC–3′	RT-PCR for GAPDH control (530 bp)
GAPDH-R	5′–TGCCTGCTTCACCACCTTCT–3′	RT-PCR for GAPDH control (530 bp)
hLZ-CP-F	5′–TGCTACCAGGGCTGGAGAAT–3′	Real-time PCR for hLZ (140 bp)
hLZ-CP-R	5′–AGCTCCTTCGCCTCCTACCA–3′	Real-time PCR for hLZ (140 bp)
Fabpi110-F	5′–TGTTCAGAGCCAGGAAATCCATA–3′	Real-time PCR for mouse Fabpi gene (110 bp) as control
Fabpi110-R	5′–CATAGGTGTCTCTTTCTTT GGTGTGT–3′	Real-time PCR for mouse Fabpi gene (110 bp) as control

Tab.1 Primers for vector construction and PCR analysis

Fig.1 Strategy for construction of pMWAP-hLZ expression vector by BAC recombineering

Fig.2 Molecular characterization of transgenic mice. (a) Schematic presentation of the pMWAP-hLZ expression vector used for microinjection containing 8.5?kb mWAP 5′ promoter, 4.8?kb hLZ gDNA and 8?kb mWAP 3′ gDNA. The primers P1, hLZ and P2 were shown in arrow; (b) PCR detection of transgenic lines. M, 100 bp DNA ladder; PC, positive control using pMWAP-hLZ vector; NC, negative control; transgenic mouse lines 2, 18, 10, 13, 25 and 26; (c) Southern blot analysis of transgenic lines. EcoRI-digested gDNA was hybridized with digoxigenin-labeled probe of amplified hLZ fragments. PC, positive control with two copiesof pMWAP-hLZ; NC, gDNA of non-transgenic mice as a negative control; (d) reverse transcription PCR analysis transgene expression in transgenic mouse tissues. The 322 bp product was abundant in lactating mammary gland of transgenic mice, while not detected in six out of seven other tissues. M, 100 bp DNA ladder; Ma, mammary gland tissue of transgenic line on day 13 of lactation; H, heart; Li, liver; Sp, spleen; Lu, lung; K, kidney; St, stomach; I, intestine; NC, mammary gland tissue of non-transgenic mouse. The mouse glyceraldehyde-3-phosphate dehydrogenase gene was used as a positive control for mRNA extraction and loading.

Tab.2 Expression of rhLZ in the milk of transgenic mouse lines

Fig.3 Western blot detection of rhLZ expressed in milk of transgenic mice

Fig.4 Lysoplate assay for lytic activity of rhLZ against Micrococcus luteus. Small white circles are 6-mm quantitative filter papers spotted with 10 mL of 1:10 diluted milk sample. Transparent zones around the quantitative filter papers indicate bacterial lysis. PC0.5, 0.5 mg natural hLZ standard; PC1.0, 1 mg natural hLZ standard; NC, milk of non-transgenic mice as a negative control; 2 and 18 are milk from female mouse lines; 25-19, 25-22 and 26-25 are milk from different female F₁ offspring of male mouse lines.

1	Bertolini L R, Meade H, Lazzarotto C R, Martins L T, Tavares K C, Bertolini M, Murray J D. The transgenic animal platform for biopharmaceutical production. Transgenic Research, 2016, 25(3): 329–343 https://doi.org/10.1007/s11248-016-9933-9 pmid: 26820414
2	Romagnolo D, DiAugustine R P. The mammary gland: protein factory of the future. Environmental Health Perspectives, 1994, 102(8): 644–646 https://doi.org/10.1289/ehp.94102644 pmid: 7895703
3	Houdebine L M. Production of pharmaceutical proteins by transgenic animals. Comparative Immunology, Microbiology and Infectious Diseases, 2009, 32(2): 107–121 https://doi.org/10.1016/j.cimid.2007.11.005 pmid: 18243312
4	Babinet C. Transgenic mice: an irreplaceable tool for the study of mammalian development and biology. Journal of the American Society of Nephrology, 2000, 11(S16): S88–S94 pmid: 11065337
5	Monzani P S, Adona P R, Ohashi O M, Meirelles F V, Wheeler M B. Transgenic bovine as bioreactors: challenges and perspectives. Bioengineered, 2016, 7(3): 123–131 https://doi.org/10.1080/21655979.2016.1171429 pmid: 27166649
6	Li G, Shi W, Chen G, Chen H, Jiao H, Yan H, Ji M, Sun H. Construction and in vivo evaluation of a mammary gland-specific expression vector for human lysozyme. Plasmid, 2014, 76: 47–53 https://doi.org/10.1016/j.plasmid.2014.09.004 pmid: 25280784
7	Yu Z, Meng Q, Yu H, Fan B, Yu S, Fei J, Wang L, Dai Y, Li N. Expression and bioactivity of recombinant human lysozyme in the milk of transgenic mice. Journal of Dairy Science, 2006, 89(8): 2911–2918 https://doi.org/10.3168/jds.S0022-0302(06)72563-2 pmid: 16840606
8	Giraldo P, Montoliu L. Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Research, 2001, 10(2): 83–103 https://doi.org/10.1023/A:1008918913249 pmid: 11305364
9	Yang P, Wang J, Gong G, Sun X, Zhang R, Du Z, Liu Y, Li R, Ding F, Tang B, Dai Y, Li N. Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin. PLoS One, 2008, 3(10): e3453 https://doi.org/10.1371/journal.pone.0003453 pmid: 18941633
10	Rival-Gervier S, Viglietta C, Maeder C, Attal J, Houdebine L M. Position-independent and tissue-specific expression of porcine whey acidic protein gene from a bacterial artificial chromosome in transgenic mice. Molecular Reproduction and Development, 2002, 63(2): 161–167 https://doi.org/10.1002/mrd.90007 pmid: 12203825
11	Zhang Y, Muyrers J P, Testa G, Stewart A F. DNA cloning by homologous recombination in Escherichia coli. Nature Biotech-nology, 2000, 18(12): 1314–1317 https://doi.org/10.1038/82449 pmid: 11101815
12	Sharan S K, Thomason L C, Kuznetsov S G, Court D L. Recombineering: a homologous recombination-based method of genetic engineering. Nature Protocols, 2009, 4(2): 206–223 https://doi.org/10.1038/nprot.2008.227 pmid: 19180090
13	Liu S, Li X, Lu D, Shang S, Wang M, Zheng M, Zhang R, Tang B, Li Q, Dai Y, Li N. High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC. Transgenic Research, 2012, 21(2): 407–414 https://doi.org/10.1007/s11248-011-9536-4 pmid: 21805108
14	Zhang R, Guo C, Sui S, Yu T, Wang J, Li N. Comprehensive assessment of milk composition in transgenic cloned cattle. PLoS One, 2012, 7(11): e49697 https://doi.org/10.1371/journal.pone.0049697 pmid: 23185411
15	Hogan B, Constantini F, Lacy E. Manipulating the mouse embryo. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986
16	Yu H, Chen J, Liu S, Zhang A, Xu X, Wang X, Lu P, Cheng G. Large-scale production of functional human lysozyme in transgenic cloned goats. Journal of Biotechnology, 2013, 168(4): 676–683 https://doi.org/10.1016/j.jbiotec.2013.10.023 pmid: 24432381
17	Tong J, Wei H, Liu X, Hu W, Bi M, Wang Y, Li Q, Li N. Production of recombinant human lysozyme in the milk of transgenic pigs. Transgenic Research, 2011, 20(2): 417–419 https://doi.org/10.1007/s11248-010-9409-2 pmid: 20549346
18	Lu D, Li Q, Wu Z, Shang S, Liu S, Wen X, Li Z, Wu F, Li N. High-level recombinant human lysozyme expressed in milk of transgenic pigs can inhibit the growth of Escherichia coli in the duodenum and influence intestinal morphology of sucking pigs. PLoS One, 2014, 9(2): e89130 https://doi.org/10.1371/journal.pone.0089130 pmid: 24586544
19	Lu D, Liu S, Shang S, Wu F, Wen X, Li Z, Li Y, Hu X, Zhao Y, Li Q, Li N. Production of transgenic-cloned pigs expressing large quantities of recombinant human lysozyme in milk. PLoS One, 2015, 10(5): e0123551 https://doi.org/10.1371/journal.pone.0123551 pmid: 25955256
20	Lu D, Liu S, Ding F, Wang H, Li J, Li L, Dai Y, Li N. Large-scale production of functional human lysozyme from marker-free transgenic cloned cows. Scientific Reports, 2016, 6(1): 22947 https://doi.org/10.1038/srep22947 pmid: 26961596
21	Jung C J, Ménoret S, Brusselle L, Tesson L, Usal C, Chenouard V, Remy S, Ouisse L H, Poirier N, Vanhove B, de Jong P J, Anegon I. Comparative analysis of piggyBac, CRISPR/Cas9 and TALEN mediated BAC transgenesis in the zygote for the generation of humanized SIRPA rats. Scientific Reports, 2016, 6(1): 31455 https://doi.org/10.1038/srep31455 pmid: 27530248
22	Pittius C W, Hennighausen L, Lee E, Westphal H, Nicols E, Vitale J, Gordon K. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice. Proceedings of the National Academy of Sciences of the United States of America, 1988, 85(16): 5874–5878 https://doi.org/10.1073/pnas.85.16.5874 pmid: 2842753
23	Wall R J, Pursel V G, Shamay A, McKnight R A, Pittius C W, Hennighausen L. High-level synthesis of a heterologous milk protein in the mammary glands of transgenic swine. Proceedings of the National Academy of Sciences of the United States of America, 1991, 88(5): 1696–1700 https://doi.org/10.1073/pnas.88.5.1696 pmid: 1705703
24	Shi G, Chen H, Wu X, Zhou Y, Liu Z, Zheng T, Huang P. A mWAP-hLF hybrid gene locus gave extremely high level expression of human lactoferrin in the milk of transgenic mice. Transgenic Research, 2009, 18(4): 573–582 https://doi.org/10.1007/s11248-009-9248-1 pmid: 19219636
25	Wu X, Lin Y, Xiong F, Zhou Y, Yu F, Deng J, Huang P, Chen H. The extremely high level expression of human serum albumin in the milk of transgenic mice. Transgenic Research, 2012, 21(6): 1359–1366 https://doi.org/10.1007/s11248-012-9612-4 pmid: 22447034
26	Wu X, Lin Y, Xi Y, Shao Z, Zhou Y, Liu F, Chen H. The development of transgenic mice for the expression of large amounts of human lysozyme in milk. Biotechnology Letters, 2014, 36(6): 1197–1202 https://doi.org/10.1007/s10529-014-1476-7 pmid: 24563307
27	Clark A J, Bissinger P, Bullock D W, Damak S, Wallace R, Whitelaw C B, Yull F. Chromosomal position effects and the modulation of transgene expression. Reproduction, Fertility, and Development, 1994, 6(5): 589–598 https://doi.org/10.1071/RD9940589 pmid: 7569038

[1]	Hongyuan ZHAO, Shanshan ZHANG, Feibing WANG, Ning ZHAO, Shaozhen HE, Qingchang LIU, Hong ZHAI. Comparative transcriptome analysis of purple-fleshed sweet potato provides insights into the molecular mechanism of anthocyanin biosynthesis[J]. Front. Agr. Sci. Eng. , 2018, 5(2): 214-225.
[2]	Xiaoming HU,Jing GUO,Chunling BAI,Zhuying WEI,Li GAO,Tingmao HU,Shorgan BOU,Guangpeng LI. Matrix attachment regions included in a bicistronic vector enhances and stabilizes follistatin gene expressions in both transgenic cells and transgenic mice[J]. Front. Agr. Sci. Eng. , 2016, 3(1): 87-96.
[3]	Yulin LI,Deping HAN,Junying LI,Dawn KOLTES,Xuemei DENG. A microarray study of altered gene expression during melanoblasts migration in normal pigmented White Leghorn and hyperpigmented mutant Silky Fowl[J]. Front. Agr. Sci. Eng. , 2014, 1(4): 299-306.
[4]	Dan LU,Shengzhe SHANG,Shen LIU,Ying WU,Fangfang WU,Tan TAN,Qiuyan LI,Yunping DAI,Xiaoxiang HU,Yaofeng ZHAO,Ning LI. Expression of recombinant human butyrylcholinesterase in the milk of transgenic mice[J]. Front. Agr. Sci. Eng. , 2014, 1(3): 179-184.
[5]	Min ZHANG,Xueqian CHENG,Dan CHU,Jingwen LIANG,Yi SUN,Li MA,Beilei XU,Min ZHENG,Meili WANG,Liming REN,Xiaoxiang HU,Qingyong MENG,Ran ZHANG,Ying GUO,Yunping DAI,Robert AITKEN,Ning LI,Yaofeng ZHAO. Depletion of conventional mature B cells and compromised specific antibody response in bovine immunoglobulin μ heavy-chain transgenic mice[J]. Front. Agr. Sci. Eng. , 2014, 1(2): 158-173.

Viewed

Full text

Abstract

Cited

Shared

Discussed