Please wait a minute...
Frontiers of Agricultural Science and Engineering

ISSN 2095-7505

ISSN 2095-977X(Online)

CN 10-1204/S

Postal Subscription Code 80-906

Front. Agr. Sci. Eng.    2016, Vol. 3 Issue (1) : 87-96    https://doi.org/10.15302/J-FASE-2016087
RESEARCH ARTICLE
Matrix attachment regions included in a bicistronic vector enhances and stabilizes follistatin gene expressions in both transgenic cells and transgenic mice
Xiaoming HU,Jing GUO,Chunling BAI,Zhuying WEI,Li GAO,Tingmao HU,Shorgan BOU(),Guangpeng LI()
Key Laboratory of National Education Ministry for Mammalian Reproductive Biology and Biotechnology/Key Laboratory of Herbivore Reproductive Biotechnology and Breeding of Ministry of Agriculture, Inner Mongolia University, Hohhot 010021, China
 Download: PDF(1288 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

In the present study, follistatin (FST) gene expression vectors with either a bicistronic gene transfer cassette alone, or a bicistron gene cassette carrying a matrix attachment region (MAR) were constructed and transfected to bovine fetal fibroblasts. Evaluations of both the integration and expression of exogenous FST indicated that the pMAR-CAG-FST-IRES-AcGFP1-polyA-MAR (pMAR-FST) vector had higher capacity to form monoclonal transgenic cells than the vector without MAR, though transient transfection and integration efficiency were similar with either construct. Remarkably, protein expression in transgenic cells with the pMAR-FST vector was significantly higher than that from the bicistronic vector. Exogenous FST was expressed in all of the pMAR-FST transgenic mice at F0, F1 and F2. Total muscle growth in F0 mice was significantly greater than in wild-type mice, with larger muscles in fore and hind limbs of transgenic mice. pMAR-FST transgenic mice were also found with more evenly distributed muscle bundles and thinner spaces between sarcolemma, which suggests a correlation between transgene expression-associated muscle development and the trend of muscle growth. In conclusion, a pMAR-FST vector, which excluded the resistant genes and frame structure, enhances and stabilizes FST gene expressions in both transfected cells and transgenic mice.

Keywords safety of transgenic      bicistron gene transfer body      transgenic mice      muscle development     
Corresponding Author(s): Shorgan BOU,Guangpeng LI   
Just Accepted Date: 16 March 2016   Online First Date: 24 March 2016    Issue Date: 07 April 2016
 Cite this article:   
Xiaoming HU,Jing GUO,Chunling BAI, et al. Matrix attachment regions included in a bicistronic vector enhances and stabilizes follistatin gene expressions in both transgenic cells and transgenic mice[J]. Front. Agr. Sci. Eng. , 2016, 3(1): 87-96.
 URL:  
https://academic.hep.com.cn/fase/EN/10.15302/J-FASE-2016087
https://academic.hep.com.cn/fase/EN/Y2016/V3/I1/87
Fig.1  Construction maps of vectors. (a) Bicistronic gene cassette; (b) pMAR-FST.
Gene name Primers Sequences (5′–3′)
MSTN ForwardReverse GCTCAAACAGCCTGAATCCAACTTACGCAGTCAAGCCCAAAGTCTC
MYoD ForwardReverse TGACCCGTGTTTCGACTCCGCAGGGAAGTGCGAGTGTT
MYoG ForwardReverse CGAGTGCCCCTTGAAGACACCGACTTCCTCTTACACACCTTACA
PAX3 ForwardReverse GTCCCATGGCTGCGTCTCTAATCTCCACGTCAGGCGTTGTC
GAPDH ForwardReverse AAATGGTGAAGGTCGGTGTGAACCAACAATCTCCACTTTGCCACTG
AcGFP ForwardReverse ATGGCAACATCCTGGGCAATAAGATCGCCGATGGGGGTATTCTGCTGGTA
FST ForwardReverse GAAAAACCTACCGCAACGAATGTGATTATTAGTCTGGTCCACCACGCA
Tab.1  Primers for real-time PCR analysis
Experimental repeats 1 2 3 Mean
Bicistronic gene cassette/% 19.31 11.83 21.03 17.39±3.99
pMAR-FST/% 23.16 14.07 25.93 21.05±5.06
Negative control/% 0.15 0.24 0.12 0.17
Tab.2  Comparison of transfection efficiency
Experimental repeats 1 2 3 Mean
Bicistronic gene cassette/% 0.85 0.39 0.59 0.61±0.19
pMAR-FST/% 1.36 1.48 1.18 1.34±0.12
Negative control/% 0.04 0.06 0.06 0.05
Tab.3  Comparison of the integration efficiency
Fig.2  FST mRNA expression by real-time PCR
Fig.3  FST translation in bovine fetalblasts. FST protein after translation was detected by western blot assay. The mean grave value was measured by using Imagej software. A, The negative control; B, bicistronic gene cassette; C, pMAR-FST vector.
Fig.4  Transgenic cell monoclones obtained from different vectors. a, Growth state of transgenic cells under the bright-field; b, fluorescence levels of transgenic cells under the dark field. M8, M33, M36, M42, M44–45, M52–53, Monoclone of transgenic cells with pMAR-FST vector; B5–7, B11, monoclone of transgenic cells with bicistronic gene cassette.
Fig.5  PCR analysis of FST-AcGFP1 (a) and FST-MAR integration (b). Lanes assigned as: 1, M8; 2, M33; 3, M36; 4, M42; 5, M44; 6, M45; 7, M52; 8, M53; 9, control of ddH2O; 10, negative control; 11, positive control.
Fig.6  RT-PCR analysis on RNA expressions.1, M8; 2, M33; 3, M36; 4, M42; 5, M44; 6, M45; 7, M52; 8, M53; 9, control of ddH20; 10, negative control; 11, positive control.
Fig.7  PCR analysis on FST gene in transgenic mice. M, DL2000 Marker; 1, 2, 7, 11, 17, the control of ddH2O; 3–5, the primary generation of transgenic mice; 6, 8–10, The first generation of transgenic mice; 12–15, the second generation of transgenic mice; 16, the plasmid of positive control.
Fig.8  RT-PCR analysis on exogenous genes expressions. (a) RT-PCR analysis of FST expression; (b) RT-PCR analysis of AcGFP expression. M, 100bp Marker; 1–3, primary generation of transgenic mice; 4–7, the first generation of transgenic mice; 8–11, the second generation of transgenic mice; 12, plasmid of positive control; 13, control of ddH2O.
Fig.9  Expressions of FST enhanced muscle development in transgenic mice. The fold changes of muscle development related gene between FST transgenic mice and wild-type mice were calculated from the results after qRT-PCR assays. (a) F0 transgenic mice; (b) F1 transgenic mice; (c) F2 transgenic mice. A, MSTN; B, MyoG; C, MyoD; D, PAX3.
Fig.10  FST transgenic mice induced strong muscle development with the increased muscle bundles. (a) The body length of transgenic mice (left) and wild-type mice (right); (b) the limbs of transgenic mice (left) and wild-type mice (right); (c) histological analysis on muscle tissues from primary generation of transgenic mice; (d) histological analysis on muscle tissues from primary generation of wild-type mice.
1 Kobelt D, Schleef M, Schmeer M, Aumann J, Schlag P M, Walther W. Performance of high quality minicircle DNA for in vitro and in vivo gene transfer. Molecular Biotechnology, 2013, 53(1): 80–89
https://doi.org/10.1007/s12033-012-9535-6
2 Müller A E, Kamisugi Y, Gruneberg R, Niedenhof I, Hörold R J, Meyer P. Palindromic sequence and A+ T-rich DNA elements promote illegitimate recombination in Nicotiana tabacum. Journal of Molecular Biology, 1999, 291(1): 29–46
https://doi.org/10.1006/jmbi.1999.2957
3 Stoger E, Williams S, Keen D, Christou P. Molecular characteristics of transgenic wheat and the effect on transgene expression. Transgenic Research, 1998, 7(6): 463–471
https://doi.org/10.1023/A:1008833324193
4 Fu X D, Duc L T, Fontana S, Bong B B, Tinjuangjun P, Sudhakar D, Twyman R M, Christou P, Kohli A. Linear transgenic constructs lacking vector backbone sequences generate low-copy-number transgenic plants with simple integration patterns. Transgenic Research, 2000, 9(1): 11–19
https://doi.org/10.1023/A:1008993730505
5 Chen Z Y, Yant S R, He C Y, Meuse L, Shen S, Kay M A. Linear DNAs concatemerize in vivo and result in sustained transgene expression in mouse liver. Molecular Therapy, 2001, 3(3): 403–410
https://doi.org/10.1006/mthe.2001.0278
6 Matake M A, Mette M F, Matzke A J. Transgene silencing by the host genome defense: implications for the evolution of epigenetic control mechanisms in plants and vertebrates. Plant Molecular Biology, 2000, 43(2–3): 401–415
7 Harraghy N, Gaussin A, Mermod N. Sustained transgene expression using MAR elements. Current Gene Therapy, 2008, 8(5): 353–366
https://doi.org/10.2174/156652308786071032
8 Breitler J C, Labeyrie A, Meynard D, Legavre T, Guiderdoni E. Efficient micro projectile bombardment-mediated transformation of rice using gene cassettes. Theoretical and Applied Genetics, 2002, 104(4): 709–719
https://doi.org/10.1007/s00122-001-0786-z
9 Bode J, Benham C, Knopp A, Mielke C. Transcriptional augmentation: modulation of gene expression by scaffold/matrix attached regions (S/MAR elements). Critical Reviews in Eukaryotic Gene Expression, 2000, 10(1): 73–90
https://doi.org/10.1615/CritRevEukarGeneExpr.v10.i1.90
10 Harraghy N, Buceta M, Regamey A, Girod P A, Mermod N. Using matrix attachment regions to improve recombinant protein production. Methods in Molecular Biology, 2012, 801: 93–110
https://doi.org/10.1007/978-1-61779-352-3_7
11 Girod P A, Nguyen D Q, Calabrese D, Puttini S, Grandjean M, Martinet D, Regamey A, Saugy D, Beckmann J S, Bucher P, Mermod N. Genome-wide prediction of matrix attachment regions that increase gene expression in mammalian cells. Nature Methods, 2007, 4(9): 747–753
https://doi.org/10.1038/nmeth1076
12 Kim J M, Kim J S, Park D H, Kang H S, Yoon J, Baek K, Yoon Y. Improved recombinant gene expression in CHO cells using matrix attachment regions. Journal of Biotechnology, 2004, 107(2): 95–105
https://doi.org/10.1016/j.jbiotec.2003.09.015
13 Zahn-Zabal M, Kobr M, Girod P A, Imhof M, Chatellard P, deJesus M, Wurm F, Mermod N. Development of stable cell lines for production or regulated expression using matrix attachment regions. Journal of Biotechnology, 2001, 87(1): 29–42
https://doi.org/10.1016/S0168-1656(00)00423-5
14 Argyros O, Wong S P, Constantinos F, Tolmachov O, Waddington S N, Howe S J, Niceta M, Coutelle C, Harbottle R P. Development of S/MAR minicircles for enhanced and persistent transgene expression in the mouse liver. Journal of Molecular, 2011, 89(5): 515–529
15 Nakatani M, Takehara Y, Sugino H, Matsumoto M, Hashimoto O, Hasegawa Y, Murakami T, Uezumi A, Takeda S, Noji S, Sunada Y, Tsuchida K. Transgenic expression of a myostatin inhibitor derived from follistatin increases skeletal muscle mass and ameliorates dystrophic pathology in mdx mice. FASEB Journal, 2008, 22(2): 477–487
https://doi.org/10.1096/fj.07-8673com
16 McPherron A C, Lawler A M, Lee S J. Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member. Nature, 1997, 387(6628): 83–90
https://doi.org/10.1038/387083a0
17 Bodnár D, Geyer N, Ruzsnavszky O, Oláh T, Hegyi B, Sztretye M, Fodor J, Dienes B, Balogh Á, Papp Z, Szabó L, Müller G, Csernoch L, Szentesi P. Hypermuscular mice with mutation in the myostatin gene display altered calcium signaling. Journal of Physiology, 2014, 592(6): 1353–1365
https://doi.org/10.1113/jphysiol.2013.261958
18 Kocamis H, Gulmez N, Aslan S, Nazli M. Follistatin alters myostatin gene expression in C2C12 muscle cells. Acta Veterinaria Hungarica, 2004, 52(2): 135–141
https://doi.org/10.1556/AVet.52.2004.2.1
19 Szabó G, Dallmann G, Müller G, Patthy L, Soller M, Varga L. A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mammalian Genome, 1998, 9(8): 671–672
https://doi.org/10.1007/s003359900843
20 Lee S J, McPherron A C. Regulation of myostatin activity and muscle growth. Proceedings of the National Academy of Sciences of the United States of America, 2001, 98(16): 9306–9311
https://doi.org/10.1073/pnas.151270098
[1] FASE-16087-of-HXM_suppl_1 Download
[1] Shen LIU, Shengzhe SHANG, Xuezhen YANG, Huihua ZHANG, Dan LU, Ning LI. Construction of a universal recombinant expression vector that regulates the expression of human lysozyme in milk[J]. Front. Agr. Sci. Eng. , 2018, 5(3): 382-389.
[2] Wen LUO, Bahareldin A. ABDALLA, Qinghua NIE, Xiquan ZHANG. The genetic regulation of skeletal muscle development: insights from chicken studies[J]. Front. Agr. Sci. Eng. , 2017, 4(3): 295-304.
[3] Dan LU,Shengzhe SHANG,Shen LIU,Ying WU,Fangfang WU,Tan TAN,Qiuyan LI,Yunping DAI,Xiaoxiang HU,Yaofeng ZHAO,Ning LI. Expression of recombinant human butyrylcholinesterase in the milk of transgenic mice[J]. Front. Agr. Sci. Eng. , 2014, 1(3): 179-184.
[4] Min ZHANG,Xueqian CHENG,Dan CHU,Jingwen LIANG,Yi SUN,Li MA,Beilei XU,Min ZHENG,Meili WANG,Liming REN,Xiaoxiang HU,Qingyong MENG,Ran ZHANG,Ying GUO,Yunping DAI,Robert AITKEN,Ning LI,Yaofeng ZHAO. Depletion of conventional mature B cells and compromised specific antibody response in bovine immunoglobulin μ heavy-chain transgenic mice[J]. Front. Agr. Sci. Eng. , 2014, 1(2): 158-173.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed