Transcription factor Pitx3 mutant mice as a model for Parkinson’s disease

doi:10.1007/s11515-016-1429-8

Front. Biol.

2016, Vol. 11

Issue (6) : 427-438 https://doi.org/10.1007/s11515-016-1429-8

REVIEW

Transcription factor Pitx3 mutant mice as a model for Parkinson’s disease

Fu-Ming Zhou¹(

),Li Li¹,Juming Yue²,John A. Dani³

¹. Department of Pharmacology, University of Tennessee College of Medicine, Memphis, TN 38103, USA
². Department of Pathology, University of Tennessee College of Medicine, Memphis, TN 38103, USA
³. Department of Neuroscience, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA

Download: PDF(991 KB) HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks

Abstract

BACKGROUND: Parkinson?s disease (PD) is a common, age-dependent degenerative neurological disorder impairing motor control function and cognition. A key pathology of PD is a degeneration of the nigrostriatal dopamine system, leading to a severe dopamine denervation in the striatum and dynsfunction of the striatal neural circuits.

OBJECTIVE: To better understand the pathophysiology of the nigrostriatal dopamine denervation and to discover better treatments, animal PD models are needed.

METHODS: The authors’ original research on the transcription factor Pitx3 null mutant mice and the relevant literature were reviewed.

RESULTS: An important feature of an animal PD model is the severe, PD-like nigrostriatal dopamine denervation. This feature is provided in the transcription factor Pitx3 null mutant mice. These mice have a severe and bilateral nigral dopamine neuron loss and dopamine denervation in the dorsal striatum, while the dopamine neuron loss in the ventral tegmental area and dopamine denervation in the ventral striatum are moderate, creating a dorsal-ventral dopamine loss gradient and mimicking the dopamine denervation pattern in PD. Pitx3 null mice show motor function deficits in the balance beam and pole tests and these deficits are reversed by L-3,4-dihydroxyphenylalanine (L-dopa). These mice also show impaired cognitive functions as indicated by reduced motor learning and avoidance memory. L-dopa, D1 agonists and, to a lesser extent, D2 agonists, induce normal horizontal movements (walking) and also dyskinesia-like movements consisting of vertical body trunk movements and waving paw movements.

CONCLUSIONS: The easy-to-maintain Pitx3 null mice with an autogenic, consistent and gradient dopamine denervation are a convenient and suitable mouse model to study the consequences of dopamine loss in PD and to test dopaminergic replacement therapies for PD.

Keywords Animal model basal ganglia L-3 4-dihydroxyphenylalanine (L-dopa) dopamine receptor supersensitivity 6-hydroxydopamine (6-OHDA) Parkinson’s disease Pitx3 striatum substantia nigra

Corresponding Author(s): Fu-Ming Zhou

Just Accepted Date: 04 November 2016 Online First Date: 01 December 2016 Issue Date: 26 December 2016

Cite this article:

Fu-Ming Zhou,Li Li,Juming Yue, et al. Transcription factor Pitx3 mutant mice as a model for Parkinson’s disease[J]. Front. Biol., 2016, 11(6): 427-438.

URL:

https://academic.hep.com.cn/fib/EN/10.1007/s11515-016-1429-8
https://academic.hep.com.cn/fib/EN/Y2016/V11/I6/427

Fig.1 Visual identification of Pitx3^+/+ (Pitx3 WT) mice and Pitx3^−/− mutant (Pitx3 null) mice. (A) Pitx3 WT mouse. (B) A Pitx3 null mouse. These 2 example mice were of 35 days old. Pitx3 WT and Pitx3 null mice look identical except that Pitx3 null mice have malformed eyes that clearly identified Pitx3 null mice on or after postnatal day 14 when Pitx3 WT and Pitx3 null mice open their eyes. A' and B' show that, compared with the Pitx3 WT mouse, the eye of the Pitx3 null mouse is much smaller. The scale in B' applies to A'. However, Pitx3Null mice eat, drink, are fertile, and do not need any special care. (C) PCR-based genotyping identifies Pitx3 WT, Pitx3^{− /−} homozygotes, and Pitx3^{+/ −} heterozygotes using the following primers: TTCTACCGAGGAAAGCTGGA and TGCTTTGCTGGACATGGTAG. A-B from Wei et al., 2013, C from Li et al., 2013.

Fig.2 The PD-like DA neuron loss pattern in Pitx3 null mice. (A) Tyrosine hydroxylase (TH)-immunostained midbrain DA neurons in a Pitx3 WT mouse. Note the dense DA dendritic network in the substantia nigra pars reticulate (SNr) in Pitx3 WT (wild-type) mice. (B) TH-immunostained mibrain DA neurons in a Pitx3 null mouse. (C) Dense DA innervation in the entire striatum in a Pitx3 WT mouse. AC, anterior commissure. (D) Severe (95-99%) DA axon loss in the dorsal striatum in a Pitx3 null mouse. The ventral striatum has about 50% residual DA axons. Modified from Ding et al., 2015.

1	Aarsland D, Bronnick K, Williams-Gray C, Weintraub D, Marder K, Kulisevsky J, Burn D, Barone P, Pagonabarraga J, Allcock L, Santangelo G, Foltynie T, Janvin C, Larsen J P, Barker R A, Emre M (2010). Mild cognitive impairment in Parkinson disease: a multicenter pooled analysis. Neurology, 75(12): 1062–1069 https://doi.org/10.1212/WNL.0b013e3181f39d0e pmid: 20855849
2	Aarsland D, Kurz M W (2010). The epidemiology of dementia associated with Parkinson disease. J Neurol Sci, 289(1-2): 18–22 https://doi.org/10.1016/j.jns.2009.08.034 pmid: 19733364
3	Alexander G E, DeLong M R, Strick P L (1986). Parallel organization of functionally segregated circuits linking basal ganglia and cortex. Annu Rev Neurosci, 9(1): 357–381 https://doi.org/10.1146/annurev.ne.09.030186.002041 pmid: 3085570
4	Ardayfio P, Moon J, Leung K K, Youn-Hwang D, Kim K S (2008). Impaired learning and memory in Pitx3 deficient aphakia mice: a genetic model for striatum-dependent cognitive symptoms in Parkinson’s disease. Neurobiol Dis, 31(3): 406–412 https://doi.org/10.1016/j.nbd.2008.05.017 pmid: 18573342
5	Bagga V, Dunnett S B, Fricker R A (2015). The 6-OHDA mouse model of Parkinson’s disease- Terminal striatal lesions provide a superior measure of neuronal loss and replacement than median forebrain bundle lesions. Behav Brain Res, 288: 107–117 https://doi.org/10.1016/j.bbr.2015.03.058 pmid: 25841616
6	Ballard P A, Tetrud J W, Langston J W (1985). Permanent human parkinsonism due to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP): seven cases. Neurology, 35(7): 949–956 https://doi.org/10.1212/WNL.35.7.949 pmid: 3874373
7	Bastide M F, Meissner W G, Picconi B, Fasano S, Fernagut P O, Feyder M, Francardo V, Alcacer C, Ding Y, Brambilla R, Fisone G, Jon Stoessl A, Bourdenx M, Engeln M, Navailles S, De Deurwaerdère P, Ko W K, Simola N, Morelli M, Groc L, Rodriguez M C, Gurevich E V, Quik M, Morari M, Mellone M, Gardoni F, Tronci E, Guehl D, Tison F, Crossman A R, Kang U J, Steece-Collier K, Fox S, Carta M, Angela Cenci M, Bézard E (2015). Pathophysiology of L-dopa-induced motor and non-motor complications in Parkinson’s disease. Prog Neurobiol, 132: 96–168 https://doi.org/10.1016/j.pneurobio.2015.07.002 pmid: 26209473
8	Bateup H S, Santini E, Shen W, Birnbaum S, Valjent E, Surmeier D J, Fisone G, Nestler E J, Greengard P (2010). Distinct subclasses of medium spiny neurons differentially regulate striatal motor behaviors. Proc Natl Acad Sci USA, 107(33): 14845–14850 https://doi.org/10.1073/pnas.1009874107 pmid: 20682746
9	Beaulieu-Boire I, Lang A E (2015). Behavioral effects of levodopa. Mov Disord, 30(1): 90–102 https://doi.org/10.1002/mds.26121 pmid: 25491470
10	Beeler J A, Cao Z F, Kheirbek M A, Zhuang X (2009). Loss of cocaine locomotor response in Pitx3-deficient mice lacking a nigrostriatal pathway. Neuropsychopharmacology, 34(5): 1149–1161 https://doi.org/10.1038/npp.2008.117 pmid: 18704092
11	Bidinost C, Matsumoto M, Chung D, Salem N, Zhang K, Stockton D W, Khoury A, Megarbane A, Bejjani B A, Traboulsi E I (2006). Heterozygous and homozygous mutations in PITX3 in a large Lebanese family with posterior polar cataracts and neurodevelopmental abnormalities. Invest Ophthalmol Vis Sci, 47(4): 1274–1280 https://doi.org/10.1167/iovs.05-1095 pmid: 16565358
12	Braak H, Ghebremedhin E, Rüb U, Bratzke H, Del Tredici K (2004). Stages in the development of Parkinson’s disease-related pathology. Cell Tissue Res, 318(1): 121–134 https://doi.org/10.1007/s00441-004-0956-9 pmid: 15338272
13	Carlsson A (2001). A half-century of neurotransmitter research: impact on neurology and psychiatry. Nobel lecture. Biosci Rep, 21(6): 691–710 https://doi.org/10.1023/A:1015556204669 pmid: 12166820
14	Chen L, Xie Z, Turkson S, Zhuang X (2015). A53T human -synuclein overexpression in transgenic mice induces pervasive mitochondria macroautophagy defects preceding dopamine neuron degeneration. J Neurosci, 35: 890–905 pmid: 25609609; PMC4300331
15	Chesselet MF, Richter F (2011). Modelling of Parkinson’s disease in mice. Lancet Neurol, 10:1108–18 pmid: 22094131
16	Chiken S, Sato A, Ohta C, Kurokawa M, Arai S, Maeshima J, Sunayama-Morita T, Sasaoka T, Nambu A(2015). Dopamine D1 receptor-mediated transmission maintains information flow through the cortico-striato-entopeduncular direct pathway to release movements. Cereb Cortex, 25:4885–97 pmid: 26443442; PMC4635926
17	Chu H Y, Atherton J F, Wokosin D, Surmeier D J, Bevan M D (2015). Heterosynaptic regulation of external globus pallidus inputs to the subthalamic nucleus by the motor cortex. Neuron, 85(2): 364–376 https://doi.org/10.1016/j.neuron.2014.12.022 pmid: 25578364
18	Coelho M, Ferreira J J (2012). Late-stage Parkinson disease. Nat Rev Neurol, 8(8):435–42 pmid: 22777251
19	Cools R, Barker R A, Sahakian B J, Robbins T W (2001). Mechanisms of cognitive set flexibility in Parkinson’s disease. Brain, 124:2503–2512 pmid: 11701603
20	Ciliax B J, Drash G W, Staley J K, Haber S, Mobley C J, Miller G W, Mufson E J, Mash D C, Levey A I (1999). Immunocytochemical localization of the dopamine transporter in human brain. J Comp Neurol, 409(1): 38–56 https://doi.org/10.1002/(SICI)1096-9861(19990621)409:1<38::AID-CNE4>3.0.CO;2-1 pmid: 10363710
21	Damier P, Hirsch E C, Agid Y, Graybiel A M (1999). The substantia nigra of the human brain. II. Patterns of loss of dopamine-containing neurons in Parkinson’s disease. Brain, 122(Pt 8): 1437–1448 https://doi.org/10.1093/brain/122.8.1437 pmid: 10430830
22	Darvas M, Palmiter R D (2009). Restriction of dopamine signaling to the dorsolateral striatum is sufficient for many cognitive behaviors. Proc Natl Acad Sci USA, 106(34): 14664–14669 https://doi.org/10.1073/pnas.0907299106 pmid: 19667174
23	de Lau L M, Breteler M M (2006). Epidemiology of Parkinson’s disease. Lancet Neurol, 5(6): 525–535 https://doi.org/10.1016/S1474-4422(06)70471-9 pmid: 16713924
24	Del Tredici K, Braak H (2016). Review: Sporadic Parkinson’s disease: development and distribution of α-synuclein pathology. Neuropathol Appl Neurobiol, 42(1): 33–50 https://doi.org/10.1111/nan.12298 pmid: 26662475
25	Deng Y, Lanciego J, Kerkerian-Le-Goff L, Coulon P, Salin P, Kachidian P, Lei W, Del Mar N, Reiner A (2015). Differential organization of cortical inputs to striatal projection neurons of the matrix compartment in rats. Front Syst Neurosci, 9: 51 https://doi.org/10.3389/fnsys.2015.00051 pmid: 25926776
26	Ding S, Li L, Zhou F M (2015). Nigral dopamine loss induces a global upregulation of presynaptic dopamine D1 receptor facilitation of the striatonigral GABAergic output. J Neurophysiol, 113(6): 1697–1711 https://doi.org/10.1152/jn.00752.2014 pmid: 25552639
27	Ding Y, Restrepo J, Won L, Hwang D Y, Kim K S, Kang U J (2007). Chronic 3,4-dihydroxyphenylalanine treatment induces dyskinesia in aphakia mice, a novel genetic model of Parkinson’s disease. Neurobiol Dis, 27(1): 11–23 https://doi.org/10.1016/j.nbd.2007.03.013 pmid: 17499513
28	Ding Y, Won L, Britt J P, Lim S A, McGehee D S, Kang U J (2011). Enhanced striatal cholinergic neuronal activity mediates L-DOPA-induced dyskinesia in parkinsonian mice. Proc Natl Acad Sci USA, 108(2): 840–845 https://doi.org/10.1073/pnas.1006511108 pmid: 21187382
29	Doig N M, Moss J, Bolam J P (2010). Cortical and thalamic innervation of direct and indirect pathway medium-sized spiny neurons in mouse striatum. J Neurosci, 30(44): 14610–14618 https://doi.org/10.1523/JNEUROSCI.1623-10.2010 pmid: 21048118
30	Doucet J P, Nakabeppu Y, Bedard P J, Hope B T, Nestler E J, Jasmin B J, Chen J S, Iadarola M J, St-Jean M, Wigle N, Blanchet P, Grondin R, Robertson G S (1996). Chronic alterations in dopaminergic neurotransmission produce a persistent elevation of deltaFosB-like protein(s) in both the rodent and primate striatum. Eur J Neurosci, 8(2): 365–381 https://doi.org/10.1111/j.1460-9568.1996.tb01220.x pmid: 8714707
31	Durieux P F, Bearzatto B, Guiducci S, Buch T, Waisman A, Zoli M, Schiffmann S N, de Kerchove d’Exaerde A (2009). D2R striatopallidal neurons inhibit both locomotor and drug reward processes. Nat Neurosci, 12(4): 393–395 https://doi.org/10.1038/nn.2286 pmid: 19270687
32	Durieux P F, Schiffmann S N, de Kerchove d’Exaerde A (2012). Differential regulation of motor control and response to dopaminergic drugs by D1R and D2R neurons in distinct dorsal striatum subregions. EMBO J, 31(3): 640–653 https://doi.org/10.1038/emboj.2011.400 pmid: 22068054
33	Ekstrand M I, Terzioglu M, Galter D, Zhu S, Hofstetter C, Lindqvist E, Thams S, Bergstrand A, Hansson F S, Trifunovic A, Hoffer B, Cullheim S, Mohammed A H, Olson L, Larsson N G (2007). Progressive parkinsonism in mice with respiratory-chain-deficient dopamine neurons. Proc Natl Acad Sci USA, 104(4): 1325–1330 https://doi.org/10.1073/pnas.0605208103 pmid: 17227870
34	Fahn S (2015). The medical treatment of Parkinson disease from James Parkinson to George Cotzias. Mov Disord, 30(1): 4–18 https://doi.org/10.1002/mds.26102 pmid: 25491387
35	Francis T C, Chandra R, Friend D M, Finkel E, Dayrit G, Miranda J, Brooks J M, Iñiguez S D, O'Donnell P, Kravitz A, Lobo M K (2015) Nucleus accumbens medium spiny neuron subtypes mediate depression-related outcomes to social defeat stress. Biol Psychiatry, 77: 212–22 pmid: 25173629
36	Franco V, Turner R S (2012). Testing the contributions of striatal dopamine loss to the genesis of parkinsonian signs. Neurobiol Dis, 47(1): 114–125 https://doi.org/10.1016/j.nbd.2012.03.028 pmid: 22498034
37	Friend D M, Kravitz A V (2014). Working together: basal ganglia pathways in action selection. Trends Neurosci, 37(6): 301–303 https://doi.org/10.1016/j.tins.2014.04.004 pmid: 24816402
38	Galati S, Stanzione P, D’Angelo V, Fedele E, Marzetti F, Sancesario G, Procopio T, Stefani A (2009). The pharmacological blockade of medial forebrain bundle induces an acute pathological synchronization of the cortico-subthalamic nucleus-globus pallidus pathway. J Physiol, 587(Pt 18): 4405–4423 https://doi.org/10.1113/jphysiol.2009.172759 pmid: 19622605
39	Gellhaar S, Marcellino D, Abrams M B, Galter D (2015). Chronic L-DOPA induces hyperactivity, normalization of gait and dyskinetic behavior in MitoPark mice. Genes Brain Behav, 14(3): 260–270 https://doi.org/10.1111/gbb.12210 pmid: 25752644
40	Gerfen C R, Bolam J P (2010) The neuroanatomical organization of the basal ganglia. In: Steiner H, Tseng K Y (eds). Handbook of Basal Ganglia Structure and Function. Academic Press. Pages 3–28
41	German D C, Manaye K F (1993). Midbrain dopaminergic neurons (nuclei A8, A9, and A10): three-dimensional reconstruction in the rat. J Comp Neurol, 331(3): 297–309 https://doi.org/10.1002/cne.903310302 pmid: 8514911
42	Glajch K E, Fleming S M, Surmeier D J, Osten P (2012). Sensorimotor assessment of the unilateral 6-hydroxydopamine mouse model of Parkinson’s disease. Behav Brain Res, 230(2): 309–316 https://doi.org/10.1016/j.bbr.2011.12.007 pmid: 22178078
43	Glass M, Dragunow M, Faull R L (2000). The pattern of neurodegeneration in Huntington’s disease: a comparative study of cannabinoid, dopamine, adenosine and GABA(A) receptor alterations in the human basal ganglia in Huntington’s disease. Neuroscience, 97(3): 505–519 https://doi.org/10.1016/S0306-4522(00)00008-7 pmid: 10828533
44	Goedert M, Spillantini M G, Del Tredici K, Braak H (2013). 100 years of Lewy pathology. Nat Rev Neurol, 9(1): 13–24 https://doi.org/10.1038/nrneurol.2012.242 pmid: 23183883
45	Golden J P, Demaro J A 3rd, Knoten A, Hoshi M, Pehek E, Johnson E M Jr, Gereau R W 4th, Jain S (2013). Dopamine-dependent compensation maintains motor behavior in mice with developmental ablation of dopaminergic neurons. J Neurosci, 33(43): 17095–17107 https://doi.org/10.1523/JNEUROSCI.0890-13.2013 pmid: 24155314
46	Gotham A M, Brown R G, Marsden C D (1988). ‘Frontal’ cognitive function in patients with Parkinson’s disease ‘on’ and ‘off’ levodopa. Brain, 111(Pt 2): 299–321 https://doi.org/10.1093/brain/111.2.299 pmid: 3378138
47	Graybiel A M, Grafton S T (2015). The striatum: where skills and habits meet. Cold Spring Harb Perspect Biol, 7(8): a021691 https://doi.org/10.1101/cshperspect.a021691 pmid: 26238359
48	Guo Y, Le W D, Jankovic J, Yang H R, Xu H B, Xie W J, Song Z, Deng H (2011). Systematic genetic analysis of the PITX3 gene in patients with Parkinson disease. Mov Disord, 26(9): 1729–1732 https://doi.org/10.1002/mds.23693 pmid: 21469209
49	Haber S N (2016). Corticostriatal circuitry. Dialogues Clin Neurosci, 18(1): 7–21 pmid: 27069376
50	Haber S N, Knutson B (2010). The reward circuit: linking primate anatomy and human imaging. Neuropsychopharmacology, 35(1): 4–26 https://doi.org/10.1038/npp.2009.129 pmid: 19812543
51	Hardman C D, Henderson J M, Finkelstein D I, Horne M K, Paxinos G, Halliday G M (2002). Comparison of the basal ganglia in rats, marmosets, macaques, baboons, and humans: volume and neuronal number for the output, internal relay, and striatal modulating nuclei. J Comp Neurol, 445(3): 238–255 https://doi.org/10.1002/cne.10165 pmid: 11920704
52	Hikosaka O, Takikawa Y, Kawagoe R (2000). Role of the basal ganglia in the control of purposive saccadic eye movements. Physiol Rev, 80(3): 953–978 pmid: 10893428
53	Hornykiewicz O (1998). Biochemical aspects of Parkinson’s disease. Neurology, 51(2 Suppl 2): S2–S9 https://doi.org/10.1212/WNL.51.2_Suppl_2.S2 pmid: 9711973
54	Hornykiewicz O (2001). Chemical neuroanatomy of the basal ganglia—normal and in Parkinson’s disease. J Chem Neuroanat, 22(1-2): 3–12 https://doi.org/10.1016/S0891-0618(01)00100-4 pmid: 11470551
55	Huerta-Ocampo I, Mena-Segovia J, Bolam J P (2014). Convergence of cortical and thalamic input to direct and indirect pathway medium spiny neurons in the striatum. Brain Struct Funct, 219(5): 1787–1800 https://doi.org/10.1007/s00429-013-0601-z pmid: 23832596
56	Hurd Y L, Suzuki M, Sedvall G C (2001). D1 and D2 dopamine receptor mRNA expression in whole hemisphere sections of the human brain. J Chem Neuroanat, 22(1-2): 127–137 https://doi.org/10.1016/S0891-0618(01)00122-3 pmid: 11470560
57	Hwang D Y, Ardayfio P, Kang U J, Semina E V, Kim K S (2003). Selective loss of dopaminergic neurons in the substantia nigra of Pitx3-deficient aphakia mice. Brain Res Mol Brain Res, 114(2): 123–131 https://doi.org/10.1016/S0169-328X(03)00162-1 pmid: 12829322
58	Hwang D Y, Fleming S M, Ardayfio P, Moran-Gates T, Kim H, Tarazi F I, Chesselet M F, Kim K S (2005). 3,4-dihydroxyphenylalanine reverses the motor deficits in Pitx3-deficient aphakia mice: behavioral characterization of a novel genetic model of Parkinson’s disease. J Neurosci, 25(8): 2132–2137 https://doi.org/10.1523/JNEUROSCI.3718-04.2005 pmid: 15728853
59	Ikemoto S, Yang C, Tan A (2015). Basal ganglia circuit loops, dopamine and motivation: A review and enquiry. Behav Brain Res, 290: 17–31 https://doi.org/10.1016/j.bbr.2015.04.018 pmid: 25907747
60	Jiménez-Jiménez F J, García-Martín E, Alonso-Navarro H, Agúndez J A ( 2014). PITX3 and risk for Parkinson’s disease: a systematic review and meta-analysis. Eur Neurol,71(1–2):49–56 pmid: 24525476
61	Katzenschlager R, Head J, Schrag A, Ben-Shlomo Y, Evans A, Lees A J, the Parkinson’s Disease Research Group of the United Kingdom (2008). Fourteen-year final report of the randomized PDRG-UK trial comparing three initial treatments in PD. Neurology, 71(7): 474–480 https://doi.org/10.1212/01.wnl.0000310812.43352.66 pmid: 18579806
62	Kirik D, Rosenblad C, Björklund A (1998). Characterization of behavioral and neurodegenerative changes following partial lesions of the nigrostriatal dopamine system induced by intrastriatal 6-hydroxydopamine in the rat. Exp Neurol, 152(2): 259–277 https://doi.org/10.1006/exnr.1998.6848 pmid: 9710526
62a	Kish S J, Shannak K, Hornykiewicz O (1988). Uneven pattern of dopamine loss in the striatum of patients with idiopathic Parkinson’s disease. Pathophysiologic and clinical implications. N Engl J Med, 318(14): 876–880
63	Kita H, Kita T (2011). Cortical stimulation evokes abnormal responses in the dopamine-depleted rat basal ganglia. J Neurosci, 31(28): 10311–10322 https://doi.org/10.1523/JNEUROSCI.0915-11.2011 pmid: 21753008
64	Kordower J H, Olanow C W, Dodiya H B, Chu Y, Beach T G, Adler C H, Halliday G M, Bartus R T (2013). Disease duration and the integrity of the nigrostriatal system in Parkinson’s disease. Brain, 136(Pt 8): 2419–2431 https://doi.org/10.1093/brain/awt192 pmid: 23884810
65	Korotkova T M, Ponomarenko A A, Haas H L, Sergeeva O A (2005) Differential expression of the homeobox gene Pitx3 in midbrain dopaminergic neurons. Eur J Neurosci. 22:1287–93 pmid: 16190884
66	Kravitz A V, Freeze B S, Parker P R, Kay K, Thwin M T, Deisseroth K, Kreitzer A C (2010). Regulation of parkinsonian motor behaviours by optogenetic control of basal ganglia circuitry. Nature, 466(7306): 622–626 https://doi.org/10.1038/nature09159 pmid: 20613723
67	Lane E L, Cheetham S C, Jenner P (2006). Does contraversive circling in the 6-OHDA-lesioned rat indicate an ability to induce motor complications as well as therapeutic effects in Parkinson’s disease? Exp Neurol, 197(2): 284–290 https://doi.org/10.1016/j.expneurol.2005.06.006 pmid: 16005456
68	Le W, Zhang L, Xie W, Li S, Dani J A (2015). Pitx3 deficiency produces decreased dopamine signaling and induces motor deficits in Pitx3(-/-) mice. Neurobiol Aging, 36(12): 3314–3320 https://doi.org/10.1016/j.neurobiolaging.2015.08.012 pmid: 26363812
69	Lee C S, Sauer H, Bjorklund A (1996). Dopaminergic neuronal degeneration and motor impairments following axon terminal lesion by instrastriatal 6-hydroxydopamine in the rat. Neuroscience, 72(3): 641–653 https://doi.org/10.1016/0306-4522(95)00571-4 pmid: 9157311
70	Lees A J, Tolosa E, Olanow C W (2015). Four pioneers of L-dopa treatment: Arvid Carlsson, Oleh Hornykiewicz, George Cotzias, and Melvin Yahr. Mov Disord, 30(1): 19–36 https://doi.org/10.1002/mds.26120 pmid: 25488030
71	Lemos J C, Friend D M, Kaplan A R, Shin J H, Rubinstein M, Kravitz A V, Alvarez V A (2016). Enhanced GABA Transmission Drives Bradykinesia Following Loss of Dopamine D2 Receptor Signaling. Neuron, 90(4): 824–838 https://doi.org/10.1016/j.neuron.2016.04.040 pmid: 27196975
72	Levey A I, Hersch S M, Rye D B, Sunahara R K, Niznik H B, Kitt C A, Price D L, Maggio R, Brann M R, Ciliax B J (1993). Localization of D1 and D2 dopamine receptors in brain with subtype-specific antibodies. Proc Natl Acad Sci U S A. 90:8861–8865 pmid: 8415621; PMC47460
73	Lewis D A, Melchitzky D S, Sesack S R, Whitehead R E, Auh S, Sampson A (2001). Dopamine transporter immunoreactivity in monkey cerebral cortex: regional, laminar, and ultrastructural localization. J Comp Neurol, 432(1): 119–136 https://doi.org/10.1002/cne.1092 pmid: 11241381
74	Li L, Qiu G, Ding S, Zhou F M (2013). Serotonin hyperinnervation and upregulated 5-HT2A receptor expression and motor-stimulating function in nigrostriatal dopamine-deficient Pitx3 mutant mice. Brain Res, 1491: 236–250 https://doi.org/10.1016/j.brainres.2012.11.010 pmid: 23159831
75	Li L, Zhou F M (2013). Parallel dopamine D1 receptor activity dependence of l-Dopa-induced normal movement and dyskinesia in mice. Neuroscience, 236: 66–76 https://doi.org/10.1016/j.neuroscience.2012.12.065 pmid: 23357114
76	Lobo M K, Zaman S, Damez-Werno D M, Koo J W, Bagot R C, DiNieri J A, Nugent A, Finkel E, Chaudhury D, Chandra R, Riberio E, Rabkin J, Mouzon E, Cachope R, Cheer J F, Han M H, Dietz D M, Self D W, Hurd Y L, Vialou V, Nestler E J (2013). DFosB induction in striatal medium spiny neuron subtypes in response to chronic pharmacological, emotional, and optogenetic stimuli. J Neurosci, 33(47): 18381–18395 https://doi.org/10.1523/JNEUROSCI.1875-13.2013 pmid: 24259563
77	Luk K C, Rymar V V, van den Munckhof P, Nicolau S, Steriade C, Bifsha P, Drouin J, Sadikot A F (2013). The transcription factor Pitx3 is expressed selectively in midbrain dopaminergic neurons susceptible to neurodegenerative stress. J Neurochem, 125(6): 932–943 https://doi.org/10.1111/jnc.12160 pmid: 23331067
78	Marin C, Rodriguez-Oroz M C, Obeso J A (2006). Motor complications in Parkinson’s disease and the clinical significance of rotational behavior in the rat: have we wasted our time? Exp Neurol, 197(2): 269–274 https://doi.org/10.1016/j.expneurol.2005.11.002 pmid: 16375892
79	Matsuda W, Furuta T, Nakamura K C, Hioki H, Fujiyama F, Arai R, Kaneko T (2009). Single nigrostriatal dopaminergic neurons form widely spread and highly dense axonal arborizations in the neostriatum. J Neurosci, 29(2): 444–453 https://doi.org/10.1523/JNEUROSCI.4029-08.2009 pmid: 19144844
80	McCann H, Cartwright H, Halliday G M (2016). Neuropathology of α-synuclein propagation and braak hypothesis. Mov Disord, 31(2): 152–160 https://doi.org/10.1002/mds.26421 pmid: 26340605
81	McRitchie D A, Cartwright H R, Halliday G M (1997). Specific A10 dopaminergic nuclei in the midbrain degenerate in Parkinson’s disease. Exp Neurol, 144(1): 202–213 https://doi.org/10.1006/exnr.1997.6418 pmid: 9126172
82	Mitchell I J, Cooper A J, Griffiths M R (1999). The selective vulnerability of striatopallidal neurons. Prog Neurobiol, 59(6): 691–719 https://doi.org/10.1016/S0301-0082(99)00019-2 pmid: 10845758
83	Nambu A (2008). Seven problems on the basal ganglia. Curr Opin Neurobiol, 18(6): 595–604 https://doi.org/10.1016/j.conb.2008.11.001 pmid: 19081243
84	Nambu A (2011). Somatotopic organization of the primate Basal Ganglia. Front Neuroanat, 5: 26 https://doi.org/10.3389/fnana.2011.00026 pmid: 21541304
85	Nelson E L, Liang C L, Sinton C M, German D C (1996). Midbrain dopaminergic neurons in the mouse: computer-assisted mapping. J Comp Neurol, 369(3): 361–371 https://doi.org/10.1002/(SICI)1096-9861(19960603)369:3<361::AID-CNE3>3.0.CO;2-3 pmid: 8743418
86	Nunes I, Tovmasian L T, Silva R M, Burke R E, Goff S P (2003). Pitx3 is required for development of substantia nigra dopaminergic neurons. Proc Natl Acad Sci USA, 100(7): 4245–4250 https://doi.org/10.1073/pnas.0230529100 pmid: 12655058
87	Nutt J G, Chung K A, Holford N H (2010). Dyskinesia and the antiparkinsonian response always temporally coincide: a retrospective study. Neurology, 74(15): 1191–1197 https://doi.org/10.1212/WNL.0b013e3181d90050 pmid: 20220120
88	Obeso J A, Rodriguez-Oroz M C, Stamelou M, Bhatia K P, Burn D J (2014). The expanding universe of disorders of the basal ganglia. Lancet, 384(9942): 523–531 https://doi.org/10.1016/S0140-6736(13)62418-6 pmid: 24954674
89	Olanow C W, Stern M B, Sethi K (2009). The scientific and clinical basis for the treatment of Parkinson disease (2009). Neurology, 72(21 Suppl 4): S1–S136 https://doi.org/10.1212/WNL.0b013e3181a1d44c pmid: 19470958
90	Oorschot D E (1996). Total number of neurons in the neostriatal, pallidal, subthalamic, and substantia nigral nuclei of the rat basal ganglia: a stereological study using the cavalieri and optical disector methods. J Comp Neurol, 366(4): 580–599 https://doi.org/10.1002/(SICI)1096-9861(19960318)366:4<580::AID-CNE3>3.0.CO;2-0 pmid: 8833111
91	Oorschot D E (2010). Cell types in the different nuclei of the basal ganglia. In: Steiner H, Tseng K Y (Eds.), Handbook of Basal Ganglia Structure and Function. London: Academic Press, pp. 63–74
92	Parkinson J (1817). An essay on shaking palsy. Originally published by Sherwood, Neely, and Jones (London, 1817), reprinted in J Neuropsychiatry Clin Neurosci. 2002 Spring; 14:223–36 pmid: 11983801
93	Redgrave P, Rodriguez M, Smith Y, Rodriguez-Oroz M C, Lehericy S, Bergman H, Agid Y, DeLong M R, Obeso J A (2010). Goal-directed and habitual control in the basal ganglia: implications for Parkinson’s disease. Nat Rev Neurosci, 11(11): 760–772 https://doi.org/10.1038/nrn2915 pmid: 20944662
94	Révy D, Jaouen F, Salin P, Melon C, Chabbert D, Tafi E, Concetta L, Langa F, Amalric M, Kerkerian-Le Goff L, Marie H, Beurrier C (2014). Cellular and behavioral outcomes of dorsal striatonigral neuron ablation: new insights into striatal functions. Neuropsychopharmacology, 39(11): 2662–2672 https://doi.org/10.1038/npp.2014.121 pmid: 24903652
95	Reyes S, Fu Y, Double K L, Cottam V, Thompson L H, Kirik D, Paxinos G, Watson C, Cooper H M, Halliday G M (2013). Trophic factors differentiate dopamine neurons vulnerable to Parkinson’s disease. Neurobiol Aging, 34(3): 873–886 https://doi.org/10.1016/j.neurobiolaging.2012.07.019 pmid: 22926168
96	Robbins T W, Cools R (2014). Cognitive deficits in Parkinson’s disease: a cognitive neuroscience perspective. Mov Disord, 29(5): 597–607 https://doi.org/10.1002/mds.25853 pmid: 24757109
97	Rothwell P E, Fuccillo M V, Maxeiner S, Hayton S J, Gokce O, Lim B K, Fowler S C, Malenka R C, Südhof T C (2014). Autism-associated neuroligin-3 mutations commonly impair striatal circuits to boost repetitive behaviors. Cell, 158(1): 198–212 https://doi.org/10.1016/j.cell.2014.04.045 pmid: 24995986
98	Samii A, Nutt J G, Ransom B R (2004). Parkinson’s disease. Lancet, 363(9423): 1783–1793 https://doi.org/10.1016/S0140-6736(04)16305-8 pmid: 15172778
99	Sano H, Chiken S, Hikida T, Kobayashi K, Nambu A (2013). Signals through the striatopallidal indirect pathway stop movements by phasic excitation in the substantia nigra. J Neurosci, 33(17): 7583–7594 https://doi.org/10.1523/JNEUROSCI.4932-12.2013 pmid: 23616563
100	Sano H, Yasoshima Y, Matsushita N, Kaneko T, Kohno K, Pastan I, Kobayashi K (2003). Conditional ablation of striatal neuronal types containing dopamine D2 receptor disturbs coordination of basal ganglia function. J Neurosci, 23(27): 9078–9088 pmid: 14534241
101	Schwarting R K, Huston J P (1996). The unilateral 6-hydroxydopamine lesion model in behavioral brain research. Analysis of functional deficits, recovery and treatments. Prog Neurobiol, 50(2-3): 275–331 https://doi.org/10.1016/S0301-0082(96)00040-8 pmid: 8971983
102	Semina E V, Ferrell R E, Mintz-Hittner H A, Bitoun P, Alward W L, Reiter R S, Funkhauser C, Daack-Hirsch S, Murray J C (1998). A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat Genet, 19(2): 167–170 https://doi.org/10.1038/527 pmid: 9620774
103	Semina E V, Murray J C, Reiter R, Hrstka R F, Graw J (2000). Deletion in the promoter region and altered expression of Pitx3 homeobox gene in aphakia mice. Hum Mol Genet, 9(11): 1575–1585 https://doi.org/10.1093/hmg/9.11.1575 pmid: 10861284
104	Semina E V, Reiter R S, Murray J C (1997). Isolation of a new homeobox gene belonging to the Pitx/Rieg family: expression during lens development and mapping to the aphakia region on mouse chromosome 19. Hum Mol Genet, 6(12): 2109–2116 https://doi.org/10.1093/hmg/6.12.2109 pmid: 9328475
105	Sesack S R, Grace A A (2010). Cortico-Basal Ganglia reward network: microcircuitry. Neuropsychopharmacology, 35(1): 27–47 https://doi.org/10.1038/npp.2009.93 pmid: 19675534
106	Siepel F J, Brønnick K S, Booij J, Ravina B M, Lebedev A V, Pereira J B, Grüner R, Aarsland D (2014). Cognitive executive impairment and dopaminergic deficits in de novo Parkinson’s disease. Mov Disord, 29(14): 1802–1808 https://doi.org/10.1002/mds.26051 pmid: 25284687
107	Simpson E H, Kellendonk C, Kandel E (2010). A possible role for the striatum in the pathogenesis of the cognitive symptoms of schizophrenia. Neuron, 65(5): 585–596 https://doi.org/10.1016/j.neuron.2010.02.014 pmid: 20223196
108	Smidt M P, Smits S M, Bouwmeester H, Hamers F P, van der Linden A J, Hellemons A J, Graw J, Burbach J P (2004). Early developmental failure of substantia nigra dopamine neurons in mice lacking the homeodomain gene Pitx3. Development, 131(5): 1145–1155 https://doi.org/10.1242/dev.01022 pmid: 14973278
109	Smidt M P, van Schaick H S, Lanctôt C, Tremblay J J, Cox J J, van der Kleij A A, Wolterink G, Drouin J, Burbach J P (1997). A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons. Proc Natl Acad Sci U S A. 94:13305–13310 pmid: 9371841; PMC24304
110	Smith Y, Galvan A, Ellender T J, Doig N, Villalba R M, Huerta-Ocampo I, Wichmann T, Bolam J P (2014). The thalamostriatal system in normal and diseased states. Front Syst Neurosci, 8: 5 https://doi.org/10.3389/fnsys.2014.00005 pmid: 24523677
111	Smits S M, Burbach J P, Smidt M P (2006). Developmental origin and fate of meso-diencephalic dopamine neurons. Prog Neurobiol, 78(1): 1–16 https://doi.org/10.1016/j.pneurobio.2005.12.003 pmid: 16414173
112	Stern Y, Langston J W (1985). Intellectual changes in patients with MPTP-induced parkinsonism. Neurology, 35(10): 1506–1509 https://doi.org/10.1212/WNL.35.10.1506 pmid: 3875807
113	Stern Y, Tetrud J W, Martin W R, Kutner S J, Langston J W (1990). Cognitive change following MPTP exposure. Neurology, 40(2): 261–264 https://doi.org/10.1212/WNL.40.2.261 pmid: 2300245
114	Svenningsson P, Westman E, Ballard C, Aarsland D (2012). Cognitive impairment in patients with Parkinson’s disease: diagnosis, biomarkers, and treatment. Lancet Neurol, 11(8): 697–707 https://doi.org/10.1016/S1474-4422(12)70152-7 pmid: 22814541
115	Thiele S L, Warre R, Khademullah C S, Fahana N, Lo C, Lam D, Talwar S, Johnston T H, Brotchie J M, Nash J E (2011). Generation of a model of L-DOPA-induced dyskinesia in two different mouse strains. J Neurosci Methods, 197(2): 193–208 https://doi.org/10.1016/j.jneumeth.2011.02.012 pmid: 21352853
116	Tremblay L, Worbe Y, Thobois S, Sgambato-Faure V, Féger J (2015). Selective dysfunction of basal ganglia subterritories: From movement to behavioral disorders. Mov Disord, 30(9): 1155–1170 https://doi.org/10.1002/mds.26199 pmid: 25772380
117	Ungerstedt U (1971). Adipsia and aphagia after 6-hydroxydopamine induced degeneration of the nigro-striatal dopamine system. Acta Physiol Scand Suppl, 367(S367): 95–122 https://doi.org/10.1111/j.1365-201X.1971.tb11001.x pmid: 4332694
118	van den Munckhof P, Luk K C, Ste-Marie L, Montgomery J, Blanchet P J, Sadikot A F, Drouin J (2003). Pitx3 is required for motor activity and for survival of a subset of midbrain dopaminergic neurons. Development, 130(11): 2535–2542 https://doi.org/10.1242/dev.00464 pmid: 12702666
118a	van den Munckhof P, Gilbert F, Chamberland M, Lévesque D, Drouin J. (2006). Striatal neuroadaptation and rescue of locomotor deficit by L-dopa in aphakia mice, a model of Parkinson's disease. J Neurochem, 96(1): 160–170
119	Varnum D S, Stevens L C (1968). Aphakia, a new mutation in the mouse. J Hered, 59(2): 147–150 pmid: 4970465
120	Walker F O (2007). Huntington’s disease. Lancet, 369(9557): 218–228 https://doi.org/10.1016/S0140-6736(07)60111-1 pmid: 17240289
121	Wei W, Li L, Yu G, Ding S, Li C, Zhou F M (2013). Supersensitive presynaptic dopamine D2 receptor inhibition of the striatopallidal projection in nigrostriatal dopamine-deficient mice. J Neurophysiol, 110(9): 2203–2216 https://doi.org/10.1152/jn.00161.2013 pmid: 23945778
122	Weintraub D, Simuni T, Caspell-Garcia C, Coffey C, Lasch S, Siderowf A, Aarsland D, Barone P, Burn D, Chahine L M, Eberling J, Espay A J, Foster E D, Leverenz J B, Litvan I, Richard I, Troyer M D, Hawkins K A, and the Parkinson’s Progression Markers Initiative (2015). Cognitive performance and neuropsychiatric symptoms in early, untreated Parkinson’s disease. Mov Disord, 30(7): 919–927 https://doi.org/10.1002/mds.26170 pmid: 25737166
123	Willard A M, Bouchard R S, Gittis A H (2015). Differential degradation of motor deficits during gradual dopamine depletion with 6-hydroxydopamine in mice. Neuroscience, 301: 254–267 https://doi.org/10.1016/j.neuroscience.2015.05.068 pmid: 26067595
124	Yarnall A J, Breen D P, Duncan G W, Khoo T K, Coleman S Y, Firbank M J, Nombela C, Winder-Rhodes S, Evans J R, Rowe J B, Mollenhauer B, Kruse N, Hudson G, Chinnery P F, O’Brien J T, Robbins T W, Wesnes K, Brooks D J, Barker R A, Burn D J, and the ICICLE-PD Study Group (2014). Characterizing mild cognitive impairment in incident Parkinson disease: the ICICLE-PD study. Neurology, 82(4): 308–316 https://doi.org/10.1212/WNL.0000000000000066 pmid: 24363137
125	Yung K K, Bolam J P, Smith A D, Hersch S M, Ciliax B J, Levey A I (1995). Immunocytochemical localization of D1 and D2 dopamine receptors in the basal ganglia of the rat: light and electron microscopy. Neuroscience, 65(3): 709–730 https://doi.org/10.1016/0306-4522(94)00536-E pmid: 7609871
126	Zhou F M (2016). The Substantia Nigra Pars Reticulata. In: Steiner H, K Tseng (eds.). Handbook of Basal Ganglia Structure and Function. pp. 293–316. Elsevier.
127	Zhou Q Y, Palmiter R D (1995). Dopamine-deficient mice are severely hypoactive, adipsic, and aphagic. Cell, 83(7): 1197–1209 https://doi.org/10.1016/0092-8674(95)90145-0 pmid: 8548806

[1]	Hansa Jain. Cationic antimicrobial peptide: LL-37 and its role in periodontitis[J]. Front. Biol., 2017, 12(2): 116-123.
[2]	Stacy Nguy,Maria Victoria Tejada-Simon. *Phenotype analysis and rescue on female FVB.129-Fmr1* knockout mice**[J]. Front. Biol., 2016, 11(1): 43-52.
[3]	Yiping LI,Chandler L. WALKER,Yi Ping ZHANG,Christopher B. SHIELDS,Xiao-Ming XU. Surgical decompression in acute spinal cord injury: A review of clinical evidence, animal model studies, and potential future directions of investigation[J]. Front. Biol., 2014, 9(2): 127-136.
[4]	Jeffrey P. CANTLE, Xiao-Hong LU, Xiaofeng GU, X. William YANG. Cellular and molecular mechanisms implicated in pathogenesis of selective neurodegeneration in Huntington’s disease[J]. Front Biol, 2012, 7(5): 459-476.
[5]	Hua SU, Ling SU, Qiuxia HE, Jing ZHAO, Shangli ZHANG, Junying MIAO, Baoxiang ZHAO, . A benzoxazine derivative specifically inhibits cell cycle progression in p53-wild type pulmonary adenocarcinoma cells[J]. Front. Biol., 2010, 5(2): 180-186.

Viewed

Full text

Abstract

Cited

Shared

Discussed