Please wait a minute...
Shopping Cart Email List Chinese
Advanced Search Fig/Tab
Frontiers in Biology

ISSN 1674-7984

ISSN 1674-7992(Online)

CN 11-5892/Q

Featured Articles  |  Most Downloaded  |  Most Reading
Online Submission Subscribe to Our RSS Content Feed
Front. Biol.    2017, Vol. 12 Issue (1) : 63-70    https://doi.org/10.1007/s11515-016-1437-8
RESEARCH ARTICLE
Association between microRNA-21, microRNA-150, and microRNA-451 expression and clinical outcome of patients with acute lymphoblastic leukemia
Ali Amin Asnafi1,Elahe Khodadi1,Neda Golchin1,Arash Alghasi1,Yousef Tavakolifar1,Najmaldin Saki1,2()
1. Health Research Institute, Research Center of Thalassemia and Hemoglobinopathy, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
2. Golestan hospital clinical research development unit, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
 Download: PDF(536 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

BACKGROUND: Acute lymphoblastic leukemia (ALL) occurs owing to the defective maturation, increased proliferation, and lack of differentiation of lymphoid cells. Evaluation of the expression levels of microRNAs (miRNAs) could help in the prognosis and improve the clinical outcome of ALL patients. Given the role of miR-21, miR-150, and miR-451 as oncogenes and tumor suppressors in lymphocytes, this study explored the relation between the expression levels of these miRNAs and the clinical outcomes of ALL patients.

METHODS: cDNA synthesis and RT-PCR were performed for peripheral blood samples from 41 patients with ALL, as well as for U937 and Jurkat cell lines to examine the expression of miR-451, miR-150, and miR-21 after miRNA purification. We also performed an epidemiological analysis in which Mann–Whitney and Chi-square tests were used to investigate the relationship between the expression of miRNAs and other clinical and laboratory data. Binary logistic regression models were used to estimate the odds ratio in univariate and multivariate analyses for clinical outcomes.

RESULTS: miR-21 and miR-150 expression was found to be decreased, while miR-451 expression showed no difference compared to the control group. There was a significant relationship between miR-451 expression and hemoglobin (Hb) levels, as well as between miR-150 expression and clinical outcomes of ALL patients.

CONCLUSION: Increased expression of miR-451 decreased the Hb levels; reduced expression of miR-150 was associated with increased relapse rate in patients. Age, increased WBC, and decreased Hb levels were associated with increased relapse rates in ALL patients. Therefore, miR-150 could be used as a biomarker to determine the clinical outcome of ALL patients.
Keywords acute lymphoblastic leukemia      miRNA      clinical outcome     
Corresponding Author(s): Najmaldin Saki   
Online First Date: 08 February 2017    Issue Date: 28 February 2017
 Cite this article:   
Ali Amin Asnafi,Elahe Khodadi,Neda Golchin, et al. Association between microRNA-21, microRNA-150, and microRNA-451 expression and clinical outcome of patients with acute lymphoblastic leukemia[J]. Front. Biol., 2017, 12(1): 63-70.
 URL:  
https://academic.hep.com.cn/fib/EN/10.1007/s11515-016-1437-8
https://academic.hep.com.cn/fib/EN/Y2017/V12/I1/63
Fig.1  MiRNAs involved in development and differentiation of lymphoid cells. MiRNAs affect different stages of lymphoid cell proliferation and differentiation from HSCs to mature B, T, and NK cells. Abbreviations: HSC, hematopoietic stem cell; CLP, common lymphoid progenitor; NK cell, natural killer cell.
Primer sequence Primer length
(bp)
MiR-21 Forward: 5'- ACGTGTTAGCTTATCAGACTG A-3' 21
Reverse: 5'- GAGCAGGGTCCGAGGT-3' 16
RT: 5'- GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACTCAACA-3' 51
MiR-451 Forward: 5'- CGAGAAACCGTTACCATTAC-3' 20
Reverse: 5'- GAGCAGGGTCCGAGGT-3' 16
RT: 5'-GTCGTATGCAGAGCAGGGTCC GAGGTATTCGCACTGCATACGACTCAACA-3' 51
MiR-150 Forward: 5'- ACATCTCCCAACCCTTGTAC-3' 18
Reverse: 5'- GAGCAGGGTCCGAGGT-3' 16
RT: 5'-GGTCGTATGCAGAGCAGGGTCCGAGGTATCCATCGCACGCATCGCACTCATACGA
CCCACTGG-3'		 64
Snord 47 Forward: 5'- ATCACTGTAAAACCGTTCA-3' 19
RT: 5'- GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACCACCTC-3' 51
Tab.1  Primer sequences of Mir-21,150 , 451 and Snord 47
Fig.2  Expression analysis of miR-21 (A), miR-150 (B), and miR-451(C) in 41 ALL samples using real-time PCR.
Fig.3  Relative expression levels of miRNAs in ALL samples showing downregulation of miR-21(A) and miR-150 (B) expression levels, and no difference in miR-451 (C) expression level, compared to the control group.
Clinical characteristics MiR- 21 (Down regulation)
(n=8)		 MiR- 21
(ND)
(n=33)		 p value MiR-451 (Down regulation)
(n=3)		 MiR-451 (ND)
(n=38)		 p value MiR-150 (Down regulation)
(n=18)		 MiR-150 (ND)
(n=23)		 p value
Sex Male 7 17 0.11 3 21 0.25 10 14 0.73
Female 1 16 0 17 8 9
Organomegaly yes 1 10 0.41 1 10 0.8 5 6 0.91
no 7 23 2 28 13 17
Clinical outcome Remission 3 9 0.67 2 10 0.20 8 4 0.049
Relapse 5 24 1 28 10 19
Age 6.5 (3-14) 5 (1-18) 0.62 14 (6-15) 5 (1-18) 0.11 5.75 (1-18) 5 (2.5-18) 0.42
WBC 8.15 (2.5-20) 6.7(1.4-50) 0.84 15 (10-20) 5.9 (1.4-50) 0.18 10 (1.4-37) 5.2 (2.5-50) 0.23
Hb 6.45 (2.2-12) 7.8(4.1-14) 0.29 12(10.9-13) 7.05(2.2-14) 0.004 7.85(4.1-12.5) 7(2.2-14) 0.77
PLT 50.5(30-279) 52(10-400) 0.80 123(102-125) 47(10-400) 0.08 45(10-279) 52(20-400) 0.71
Tab.2  Demographic, laboratory and clinical data in ALL cases according to MiR-21, MiR-451 and MiR-150 expression
p value OR 95% CI
Age 0.001 0.74 (0.61 , 0.89)
Hb 0.004 0.57 (0.38 , 0.84)
PLT 0.12 0.99 (0.98 , 1.01)
WBC 0.004 0.61 (0.43 , 0.86)
Sex (Male vs. Female) 0.48 1.64 (0.42 , 6.36)
21 expression (vs. down regulation)-MiR 0.57 1.6 (0.32 , 8.11)
451 expression (vs. down regulation)-MiR 0.18 0.18 (0.02 , 2.20)
150 expression (vs. down regulation)-MiR 0.007 3.8 (0.92 , 15.78)
Tab.3  Univariate analysis for clinical outcome (relapse-remission) as dependent parameter with other covariates in ALL cases
p value OR 95% CI
Age 0.13 0.72 (0.47 , 1.10)
WBC 0.02 0.69 (0.51 , 0.95)
Hb 0.37 0.70 (0.32 , 1.53)
150 expression (vs. down regulation)-MiR 0.42 3.94 (0.15 , 106.7)
Tab.4  Multivariate analysis for clinical outcome (relapse-remission) as dependent parameter with other covariates in ALL cases
1 Anindo M I K, Yaqinuddin A (2012). Insights into the potential use of microRNAs as biomarker in cancer. Int J Surg, 10(9): 443–449
https://doi.org/10.1016/j.ijsu.2012.08.006 pmid: 22906693
2 Babashah S, Sadeghizadeh M, Tavirani M R, Farivar S, Soleimani M (2012). Aberrant microRNA expression and its implications in the pathogenesis of leukemias. Cell Oncol (Dordr), 35(5): 317–334
https://doi.org/10.1007/s13402-012-0095-3 pmid: 22956261
3 Bai H, Xu R, Cao Z, Wei D, Wang C (2011). Involvement of miR-21 in resistance to daunorubicin by regulating PTEN expression in the leukaemia K562 cell line. FEBS Lett, 585(2): 402–408
https://doi.org/10.1016/j.febslet.2010.12.027 pmid: 21187093
4 Bustin S A, Benes V, Garson J A, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl M W, Shipley G L, Vandesompele J, Wittwer C T (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem, 55(4): 611–622
https://doi.org/10.1373/clinchem.2008.112797 pmid: 19246619
5 Duyu M, Durmaz B, Gunduz C, Vergin C, Yilmaz Karapinar D, Aksoylar S, Kavakli K, Cetingul N, Irken G, Yaman Y, Ozkinay F, Cogulu O (2014). Prospective evaluation of whole genome microRNA expression profiling in childhood acute lymphoblastic leukemia. BioMed Res Int, 2014: 967585
https://doi.org/10.1155/2014/967585 pmid: 24955371
6 Ghisi M, Corradin A, Basso K, Frasson C, Serafin V, Mukherjee S, Mussolin L, Ruggero K, Bonanno L, Guffanti A, De Bellis G, Gerosa G, Stellin G, D’Agostino D M, Basso G, Bronte V, Indraccolo S, Amadori A, Zanovello P (2011). Modulation of microRNA expression in human T-cell development: targeting of NOTCH3 by miR-150. Blood, 117(26): 7053–7062
https://doi.org/10.1182/blood-2010-12-326629 pmid: 21551231
7 Gordon J E, Wong J J L, Rasko J E (2013). MicroRNAs in myeloid malignancies. Br J Haematol, 162(2): 162–176
https://doi.org/10.1111/bjh.12364 pmid: 23679825
8 Hussein K, Theophile K, Büsche G, Schlegelberger B, Göhring G, Kreipe H, Bock O (2010). Significant inverse correlation of microRNA-150/MYB and microRNA-222/p27 in myelodysplastic syndrome. Leuk Res, 34(3): 328–334
https://doi.org/10.1016/j.leukres.2009.06.014 pmid: 19615744
9 Lawrie C H (2013). MicroRNAs in hematological malignancies. Blood Rev, 27(3): 143–154
https://doi.org/10.1016/j.blre.2013.04.002 pmid: 23623930
10 Li X, Sanda T, Look A T, Novina C D, von Boehmer H (2011). Repression of tumor suppressor miR-451 is essential for NOTCH1-induced oncogenesis in T-ALL. J Exp Med, 208(4): 663–675
https://doi.org/10.1084/jem.20102384 pmid: 21464222
11 Lopotová T, Záčková M, Klamová H, Moravcová J (2011). MicroRNA-451 in chronic myeloid leukemia: miR-451-BCR-ABL regulatory loop? Leuk Res, 35(7): 974–977
https://doi.org/10.1016/j.leukres.2011.03.029 pmid: 21511335
12 Naderi M, Abdul Tehrani H, Soleimani M, Shabani I, Hashemi S M (2015). A home-brew real-time PCR assay for reliable detection and quantification of mature miR-122. Appl Immunohistochem Mol Morphol, 23(8): 601–606
https://doi.org/10.1097/PAI.0000000000000125 pmid: 25075470
13 Pfaffl M W, Horgan G W, Dempfle L (2002). Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res, 30(9): e36–e36
https://doi.org/10.1093/nar/30.9.e36 pmid: 11972351
14 Rossi S, Shimizu M, Barbarotto E, Nicoloso M S, Dimitri F, Sampath D, Fabbri M, Lerner S, Barron L L, Rassenti L Z, Jiang L, Xiao L, Hu J, Secchiero P, Zauli G, Volinia S, Negrini M, Wierda W, Kipps T J, Plunkett W, Coombes K R, Abruzzo L V, Keating M J, Calin G A (2010). microRNA fingerprinting of CLL patients with chromosome 17p deletion identify a miR-21 score that stratifies early survival. Blood, 116(6): 945–952
https://doi.org/10.1182/blood-2010-01-263889 pmid: 20393129
15 Saki N, Abroun S, Soleimani M, Hajizamani S, Shahjahani M, Kast R E, Mortazavi Y (2015). Involvement of MicroRNA in T-Cell Differentiation and Malignancy. Int J Hematol Oncol Stem Cell Res, 9(1): 33–49
pmid: 25802699
16 Saki N, Abroun S, Soleimani M, Mortazavi Y, Kaviani S, Arefian E (2014). The roles of miR-146a in the differentiation of Jurkat T-lymphoblasts. Hematology, 19(3): 141–147
https://doi.org/10.1179/1607845413Y.0000000105 pmid: 23796062
17 Salzman D W, Weidhaas J B (2013). SNPing cancer in the bud: microRNA and microRNA-target site polymorphisms as diagnostic and prognostic biomarkers in cancer. Pharmacol Ther, 137(1): 55–63
https://doi.org/10.1016/j.pharmthera.2012.08.016 pmid: 22964086
18 Shahrabi S, Azizidoost S, Shahjahani M, Rahim F, Ahmadzadeh A, Saki N (2014). New insights in cellular and molecular aspects of BM niche in chronic myelogenous leukemia. Tumour Biol, 35(11): 10627–10633
https://doi.org/10.1007/s13277-014-2610-9 pmid: 25234716
19 Shi C, Zhang X, Li X, Zhang L, Li L, Sun Z, Fu X, Wu J, Chang Y, Li W, Chen Q, Zhang M (2016). Effects of microRNA-21 on the biological functions of T-cell acute lymphoblastic lymphoma/leukemia. Oncol Lett, 12(5): 4173–4180
pmid: 27895788
20 Tavakoli F, Jaseb K, Far M A J, Soleimani M, Khodadi E, Saki N (2016). Evaluation of microRNA-146a expression in acute lymphoblastic leukemia. Frontiers in Biology, 11(1): 53–58
https://doi.org/10.1007/s11515-016-1387-1
21 Wang M, Tan L P, Dijkstra M K, van Lom K, Robertus J L, Harms G, Blokzijl T, Kooistra K, van T’veer M B, Rosati S, Visser L, Jongen-Lavrencic M, Kluin P M, van den Berg A (2008). miRNA analysis in B-cell chronic lymphocytic leukaemia: proliferation centres characterized by low miR-150 and high BIC/miR-155 expression. J Pathol, 215(1): 13–20
https://doi.org/10.1002/path.2333 pmid: 18348159
22 Whitman S P, Maharry K, Radmacher M D, Becker H, Mrózek K, Margeson D, Holland K B, Wu Y Z, Schwind S, Metzeler K H, Wen J, Baer M R, Powell B L, Carter T H, Kolitz J E, Wetzler M, Moore J O, Stone R M, Carroll A J, Larson R A, Caligiuri M A, Marcucci G, Bloomfield C D (2010). FLT3 internal tandem duplication associates with adverse outcome and gene- and microRNA-expression signatures in patients 60 years of age or older with primary cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study. Blood, 116(18): 3622–3626
https://doi.org/10.1182/blood-2010-05-283648 pmid: 20656931
23 Yan L X, Huang X F, Shao Q, Huang M Y, Deng L, Wu Q L, Zeng Y X, Shao J Y (2008). MicroRNA miR-21 overexpression in human breast cancer is associated with advanced clinical stage, lymph node metastasis and patient poor prognosis. RNA, 14(11): 2348–2360
https://doi.org/10.1261/rna.1034808 pmid: 18812439
24 Zhao H, Wang D, Du W, Gu D, Yang R (2010). MicroRNA and leukemia: tiny molecule, great function. Crit Rev Oncol Hematol, 74(3): 149–155
https://doi.org/10.1016/j.critrevonc.2009.05.001 pmid: 19520590
[1] Razia Rahman, Lokesh Kumar Gahlot, Yasha Hasija. miRACA: A database for miRNAs associated with cancers and age related disorders (ARD)[J]. Front. Biol., 2018, 13(1): 36-50.
[2] Pang-Kuo Lo,Benjamin Wolfson,Qun Zhou. Cellular, physiological and pathological aspects of the long non-coding RNA NEAT1[J]. Front. Biol., 2016, 11(6): 413-426.
[3] Farzaneh Tavakoli,Kaveh Jaseb,Mohammad Ali Jalali Far,Masoud Soleimani,Elahe Khodadi,Najmaldin Saki. Evaluation of microRNA-146a expression in acute lymphoblastic leukemia[J]. Front. Biol., 2016, 11(1): 53-58.
[4] Javad Mohammdai-asl,Abolfazl Ramezani,Fatemeh Norozi,Amal Saki Malehi,Ali Amin Asnafi,Mohammad Ali Jalali Far,Seyed Hadi Mousavi,Najmaldin Saki. MicroRNAs in erythropoiesis and red blood cell disorders[J]. Front. Biol., 2015, 10(4): 321-332.
[5] Kazuhiro TANAKA, Nikhat J. SIDDIQI, Abdullah S. ALHOMIDA, Akhlaq A. FAROOQUI, Wei-Yi ONG. Differential regulation of cPLA2 and iPLA2 expression in the brain[J]. Front Biol, 2012, 7(6): 514-521.
[6] Yan LI, Wenming WANG, Jian-Min ZHOU. Role of small RNAs in the interaction between Arabidopsis and Pseudomonas syringae[J]. Front Biol, 2011, 6(6): 462-467.
[7] Francesca FANINI, Ivan VANNINI, Muller FABBRI. MicroRNAs and drug modulation in cancer: an intertwined new story[J]. Front Biol, 2011, 6(5): 351-356.
[8] Rui TANG, Ke ZEN. Gold glitters everywhere: nucleus microRNAs and their functions[J]. Front Biol, 2011, 06(01): 69-75.
[9] Ming ZHOU, Lianfeng GU, Pingchuan LI, Xianwei SONG, Liya WEI, Zhiyu CHEN, Xiaofeng CAO. Degradome sequencing reveals endogenous small RNA targets in rice ( Oryza sativa L. ssp . indica )[J]. Front. Biol., 2010, 5(1): 67-90.
[10] Jinbiao MA, Ying HUANG, . Post-transcriptional regulation of miRNA biogenesis and functions[J]. Front. Biol., 2010, 5(1): 32-40.
[11] MU Junjie, YAO Xue, CHEN Qimin, GENG Yunqi, QIAO Wentao. MicroRNAs and their role in viral infection[J]. Front. Biol., 2007, 2(1): 15-20.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed