Please wait a minute...
Frontiers of Environmental Science & Engineering

ISSN 2095-2201

ISSN 2095-221X(Online)

CN 10-1013/X

Postal Subscription Code 80-973

2018 Impact Factor: 3.883

Front. Environ. Sci. Eng.    2020, Vol. 14 Issue (1) : 1    https://doi.org/10.1007/s11783-019-1180-x
RESEARCH ARTICLE
Increasing prevalence of antibiotic resistance genes in manured agricultural soils in northern China
Nan Wu1, Weiyu Zhang1, Shiyu Xie1, Ming Zeng2(), Haixue Liu3, Jinghui Yang4, Xinyuan Liu1, Fan Yang1
1. College of Engineering and Technology, Tianjin Agricultural University, Tianjin 300384, China
2. College of Marine and Environmental Sciences, Tianjin University of Science & Technology, Tianjin 300457, China
3. Laboratory of Agricultural Analysis, Tianjin Agricultural University, Tianjin 300384, China
4. College of Horticulture and Landscape, Tianjin Agricultural University, Tianjin 300384, China
 Download: PDF(1062 KB)   HTML
 Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

• Manure application increased the abundances of ARGs and MGEs in agricultural soils.

• Five classes of ARGs and two MGEs were prevalent in manured and unfertilized soils.

• Genera Pseudomonas and Bacteroidetes might be the dominant hosts of intI1 and ermF.

• The abundances of ARGs positively correlated with TC, TN, OM, Cu, Zn, Pb and MGEs.

Land application of manure tends to result in the dissemination of antibiotic resistance in the environment. In this study, the influence of long-term manure application on the enrichment of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in agricultural soils was investigated. All the analyzed eight ARGs (tetA, tetW, tetX, sulI, sulII, ermF, aac(6’)-Ib-cr and blaTEM) and two MGEs (intI1 and Tn916/1545) were detected in both the manured and control soils, with relative abundances ranging from 10-6 to 10-2. Compared with the control soil, the relative abundances of ARGs and MGEs in manured soils were enriched 1.0–18.1 fold and 0.6–69.1 fold, respectively. High-throughput sequencing analysis suggested that at the phylum level, the bacteria carrying intI1 and ermF might be mainly affiliated with Proteobacteria and Bacteroides, respectively. The dominant genera carrying intI1 and ermF could be Pseudomonas and Bacteroides, independent of manure application. Correlation analysis revealed that ARGs had strong links with soil physicochemical properties (TC, TN, and OM), heavy metals (Cu, Zn and Pb) and MGEs, indicating that the profile and spread of ARGs might be driven by the combined impacts of multiple factors. In contrast, soil pH and C/N exhibited no significant relationships with ARGs. Our findings provide evidence that long-term manure application could enhance the prevalence and stimulate the propagation of antibiotic resistance in agricultural soils.

Keywords Antibiotic resistance      Mobile genetic elements      Soil      Manure      Heavy metals     
Corresponding Author(s): Ming Zeng   
Issue Date: 22 October 2019
 Cite this article:   
Nan Wu,Weiyu Zhang,Shiyu Xie, et al. Increasing prevalence of antibiotic resistance genes in manured agricultural soils in northern China[J]. Front. Environ. Sci. Eng., 2020, 14(1): 1.
 URL:  
https://academic.hep.com.cn/fese/EN/10.1007/s11783-019-1180-x
https://academic.hep.com.cn/fese/EN/Y2020/V14/I1/1
Target Genes Primer Sequences (5′—3′) Amplicon size (bp) Annealing temp (°C) Ref.
tetA tetA-FW GCTACATCCTGCTTGCCTTC 210 55 Ng et al. (2001)
tetA-RV CATAGATCGCCGTGAAGAGG
tetW tetW-FW GAGAGCCTGCTATATGCCAGC 168 60 Aminov et al. (2001)
tetW-RV GGGCGTATCCACAATGTTAAC
tetX tetX-FW CAATAATTGGTGGTGGACCC 468 58 Ng et al. (2001)
tetX-RV TTCTTACCTTGGACATCCCG
sulI sulI-FW CGCACCGGAAACATCGCTGCAC 163 56 Negreanu et al. (2012)
sulI-RV TGAAGTTCCGCCGCAAGGCTCG
sulII sulII-FW TCCGGTGGAGGCCGGTATCTGG 191 60 Negreanu et al. (2012)
sulII-RV CGGGAATGCCATCTGCCTTGAG
ermF ermF-FW CGACACAGCTTTGGTTGAAC 309 56 Chen et al. (2007)
ermF-RV GGACCTACCTCATAGACAAG
acc(6’)-Ib-cr acc(6’)-FW TTGCGATGCTCTATGAGTGGCTA 482 55 Zhang et al. (2016)
acc(6’)-RV CTCGAATGCCTGGCGTGTTT
blaTEM blaTEM-FW ATCAGCAATAAACCAGC 516 55 Zhang et al. (2016)
blaTEM-RV CCCCGAAGAACGTTTTC
intI1 HS463a CTGGATTTCGATCACGGCACG 473 55 Hardwick et al. (2008)
HS464 GGWTACCTTGTTACGACTT
Tn916/1545 Tn916/1545-FW GACAGTATTAAGCCATCAGAC 142 41 Zhang et al. (2016)
Tn916/1545-RV TCTTCCGAACACAATCATCT
16S rRNA 1369F CGGTGAATACGTTCYCGG 123 56 Suzuki et al. (2000)
1492R GGWTACCTTGTTACGACTT
Tab.1  Primer sequences of the ARGs, MGEs, and 16S rRNA
Target
Genes
Primer Sequences (5′—3′) Amplicon size (bp) Annealing temp (℃) Ref.
tetA tetA-FW GCTACATCCTGCTTGCCTTC 210 55 Ng et al. (2001)
tetA-RV CATAGATCGCCGTGAAGAGG
tetW tetW-FW GAGAGCCTGCTATATGCCAGC 168 60 Aminov et al. (2001)
tetW-RV GGGCGTATCCACAATGTTAAC
tetX tetX-FW CAATAATTGGTGGTGGACCC 468 58 Ng et al. (2001)
tetX-RV TTCTTACCTTGGACATCCCG
sulI sulI-FW CGCACCGGAAACATCGCTGCAC 163 56 Negreanu et al. (2012)
sulI-RV TGAAGTTCCGCCGCAAGGCTCG
sulII sulII-FW TCCGGTGGAGGCCGGTATCTGG 191 60 Negreanu et al. (2012)
sulII-RV CGGGAATGCCATCTGCCTTGAG
ermF ermF-FW CGACACAGCTTTGGTTGAAC 309 56 Chen et al. (2007)
ermF-RV GGACCTACCTCATAGACAAG
aac(6’)-Ib-cr acc(6’)-FW TTGCGATGCTCTATGAGTGGCTA 482 55 Zhang et al. (2016)
acc(6’)-RV CTCGAATGCCTGGCGTGTTT
blaTEM blaTEM-FW ATCAGCAATAAACCAGC 516 55 Zhang et al. (2016)
blaTEM-RV CCCCGAAGAACGTTTTC
intI1 HS463a CTGGATTTCGATCACGGCACG 473 55 Hardwick et al. (2008)
HS464 GGWTACCTTGTTACGACTT
Tn916/1545 Tn916/1545-FW GACAGTATTAAGCCATCAGAC 142 41 Zhang et al. (2016)
Tn916/1545-RV TCTTCCGAACACAATCATCT
16S rRNA 1369F CGGTGAATACGTTCYCGG 123 56 Suzuki et al. (2000)
1492R GGWTACCTTGTTACGACTT
Tab.2  Primer sequences of the ARGs, MGEs, and 16S rRNA
Samples Cr Ni Cu Zn As Pb Cd
CK 77.50±1.68 43.15±0.47 39.39±0.79 32.93±0.86 17.47±0.27 23.84±0.12 ND
JX 123.18±11.49** 47.46±1.36** 25.03±1.32 13.61±1.01 8.33±0.04 10.29±0.63 ND
XQ 82.28±3.54 47.89±0.40** 74.59±1.06** 104.78±0.95** 19.86±0.17** 24.23±0.49 0.10±0.01
WQ 62.02±2.14 42.28±0.21 36.61±1.22 39.20±0.46** 13.45±0.22 23.43±0.31 0.10±0.01
NH 79.94±2.52 37.63±0.53 147.13±3.15** 205.51±1.42** 10.42±0.13 40.15±0.89** 0.35±0.02
DG 60.22±1.63 38.15±0.33 36.52±0.34 28.17±0.25 11.82±0.09 17.29±0.50 ND
JH 97.59±1.24* 45.98±0.52* 26.70±0.26 10.39±0.41 8.36±0.20 10.75±0.07 ND
BD 129.47±8.01** 53.63±0.77** 46.49±1.40** 20.98±0.43 13.69±0.09 21.86±0.26 ND
Tab.3  Heavy metal concentrations in surface soils from different sites (mg/kg DW)
Fig.1  Absolute abundances of ARGs, MGEs and 16S rRNA in soils from different sites. Plotted values are log10-transformed numbers of gene copies per g dry soil.
Fig.2  Relative abundances of ARGs and MGEs in soils from different sites.
Samples Tags OTUs Chao1 Coverage Shannon
intI1 ermF intI1 ermF intI1 ermF intI1 ermF intI1 ermF
CK 36726 97845 339 230 340 236 0.9960 0.9996 2.89 3.87
JX 14516 62790 441 233 466 244 0.9940 0.9994 1.82 0.85
XQ 20182 64383 309 48 334 59 0.9929 0.9998 1.86 0.37
WQ 23260 58540 250 187 319 200 0.9919 0.9994 1.26 0.44
NH 33810 56807 336 22 359 29 0.9908 0.9998 1.12 0.10
DG 16180 60648 152 261 179 265 0.9963 0.9997 1.92 1.48
JH 32667 65265 591 129 586 235 0.9918 0.9990 5.06 1.79
BD 36797 61476 432 17 419 17 0.9955 0.9999 6.18 1.43
Tab.4  Bacterial diversity index values of intI1 and ermF in soil samples
Fig.3  The host bacteria composition for (a) intI1 and (b) ermF at the phylum level (Phyla with relative abundances less than 0.5% are pooled into the category “others”).
Fig.4  The host bacteria composition for intI1 at the genus level (top 20 genera).
Fig.5  The host bacteria composition for ermF at the genus level (top 20 genera).
Genes pH TC OM TN C/N 16S rRNA Cr Ni Cu Zn As Pb intI1 Tn916/1545 MGEs
tetA -0.619 0.809* 0.673 0.798* 0.103 0.712* -0.277 -0.292 0.876** 0.927** 0.275 0.737* 0.706 0.730* 0.711*
tetW -0.541 0.557 0.662 0.416 0.367 0.402 0.257 -0.110 0.464 0.503 -0.242 0.175 0.476 0.436 0.469
tetX -0.305 0.773* 0.654 0.840** 0.009 0.913** -0.469 -0.671 0.634 0.657 -0.253 0.678 0.778* 0.746* 0.772*
sulI -0.591 0.775* 0.824* 0.683 0.152 0.946** -0.143 -0.521 0.927** 0.899** -0.244 0.799* 0.998** 0.990** 0.997**
sulII -0.588 0.775* 0.822* 0.685 0.149 0.949** -0.148 -0.525 0.925** 0.897** -0.245 0.802* 0.998** 0.990** 0.998**
ermF -0.579 0.791* 0.820* 0.716* 0.135 0.968** -0.182 -0.541 0.920** 0.897** -0.240 0.814* 0.999** 0.989** 0.998**
aac(6’)-Ib-cr -0.404 0.844** 0.767* 0.867** 0.134 0.845** -0.317 -0.619 0.621 0.671 -0.324 0.525 0.745* 0.696 0.736*
blaTEM -0.101 -0.097 0.057 -0.188 0.245 -0.241 0.503 0.235 -0.336 -0.298 -0.451 -0.544 -0.206 -0.263 -0.217
ARGs -0.583 0.809* 0.835** 0.735* 0.144 0.970** -0.185 -0.552 0.920** 0.901** -0.248 0.804* 0.998** 0.986** 0.997**
Tab.5  Correlation analysis among ARGs, MGEs, soil properties and heavy metals
1 Y Agersø, D Sandvang (2005). Class 1 integrons and tetracycline resistance genes in Alcaligenes, Arthrobacter, and Pseudomonas spp. isolated from pigsties and manured soil. Applied and Environmental Microbiology, 71(12): 7941–7947
https://doi.org/10.1128/AEM.71.12.7941-7947.2005 pmid: 16332771
2 R I Aminov, N Garrigues-Jeanjean, R I Mackie (2001). Molecular ecology of tetracycline resistance: Development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Applied and Environmental Microbiology, 67(1): 22–32
https://doi.org/10.1128/AEM.67.1.22-32.2001 pmid: 11133424
3 A Brenciani, E Tiberi, A Bacciaglia, D Petrelli, P E Varaldo, E Giovanetti (2011). Two distinct genetic elements are responsible for erm(TR)-mediated erythromycin resistance in tetracycline-susceptible and tetracycline-resistant strains of Streptococcus pyogenes. Antimicrobial Agents and Chemotherapy, 55(5): 2106–2112
https://doi.org/10.1128/AAC.01378-10 pmid: 21343455
4 K G Byrne-Bailey, W H Gaze, L Zhang, P Kay, A Boxall, P M Hawkey, E M Wellington (2011). Integron prevalence and diversity in manured soil. Applied and Environmental Microbiology, 77(2): 684–687
https://doi.org/10.1128/AEM.01425-10 pmid: 21097590
5 J Chen, Z Yu, F C Michel Jr, T Wittum, M Morrison (2007). Development and application of real-time PCR assays for quantification of erm genes conferring resistance to macrolides-lincosamides-streptogramin B in livestock manure and manure management systems. Applied and Environmental Microbiology, 73(14): 4407–4416
https://doi.org/10.1128/AEM.02799-06 pmid: 17496134
6 Q Chen, X An, H Li, J Su, Y Ma, Y G Zhu (2016). Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil. Environment International, 92– 93: 1–10
https://doi.org/10.1016/j.envint.2016.03.026 pmid: 27043971
7 W O Chung, C Werckenthin, S Schwarz, M C Roberts (1999). Host range of the ermF rRNA methylase gene in bacteria of human and animal origin. Journal of Antimicrobial Chemotherapy, 43(1): 5–14
https://doi.org/10.1093/jac/43.1.5 pmid: 10381095
8 E Cui, Y Wu, Y Zuo, H Chen (2016). Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresource Technology, 203: 11–17
https://doi.org/10.1016/j.biortech.2015.12.030 pmid: 26720134
9 Z Eitel, J Sóki, E Urbán, E Nagy (2013). The prevalence of antibiotic resistance genes in Bacteroides fragilis group strains isolated in different European countries. Anaerobe, 21: 43–49
https://doi.org/10.1016/j.anaerobe.2013.03.001 pmid: 23500457
10 K J Forsberg, A Reyes, B Wang, E M Selleck, M O Sommer, G Dantas (2012). The shared antibiotic resistome of soil bacteria and human pathogens. Science, 337(6098): 1107–1111
https://doi.org/10.1126/science.1220761 pmid: 22936781
11 P Gao, D Mao, Y Luo, L Wang, B Xu, L Xu (2012). Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance genes in aquaculture environment. Water Research, 46(7): 2355–2364
https://doi.org/10.1016/j.watres.2012.02.004 pmid: 22377146
12 M R Gillings, W H Gaze, A Pruden, K Smalla, J M Tiedje, Y G Zhu (2015). Using the class 1 integron-integrase gene as a proxy for anthropogenic pollution. ISME Journal, 9(6): 1269–1279
https://doi.org/10.1038/ismej.2014.226 pmid: 25500508
13 A Guo, J Gu, X Wang, R Zhang, Y Yin, W Sun, X Tuo, L Zhang (2017). Effects of superabsorbent polymers on the abundances of antibiotic resistance genes, mobile genetic elements, and the bacterial community during swine manure composting. Bioresource Technology, 244(Pt 1): 658–663
https://doi.org/10.1016/j.biortech.2017.08.016 pmid: 28813691
14 T Guo, C Lou, W Zhai, X Tang, M Z Hashmi, R Murtaza, Y Li, X Liu, J Xu (2018). Increased occurrence of heavy metals, antibiotics and resistance genes in surface soil after long-term application of manure. Science of the Total Environment, 635: 995–1003
https://doi.org/10.1016/j.scitotenv.2018.04.194 pmid: 29710621
15 S A Hardwick, H W Stokes, S Findlay, M Taylor, M R Gillings (2008). Quantification of class 1 integron abundance in natural environments using real-time quantitative PCR. FEMS Microbiology Letters, 278(2): 207–212
https://doi.org/10.1111/j.1574-6968.2007.00992.x pmid: 18042230
16 H Heuer, H Schmitt, K Smalla (2011). Antibiotic resistance gene spread due to manure application on agricultural fields. Current Opinion in Microbiology, 14(3): 236–243
https://doi.org/10.1016/j.mib.2011.04.009 pmid: 21546307
17 M Hvistendahl (2012). China takes aim at rampant antibiotic resistance. Science, 336(6083): 795
https://doi.org/10.1126/science.336.6083.795 pmid: 22605727
18 X Ji, Q Shen, F Liu, J Ma, G Xu, Y Wang, M Wu (2012). Antibiotic resistance gene abundances associated with antibiotics and heavy metals in animal manures and agricultural soils adjacent to feedlots in Shanghai, China. Journal of Hazardous Materials, 235– 236(20): 178–185
https://doi.org/10.1016/j.jhazmat.2012.07.040 pmid: 22868748
19 B O Johnsen, N Handal, R Meisal, J V Bjørnholt, P Gaustad, T M Leegaard (2017). erm gene distribution among Norwegian Bacteroides isolates and evaluation of phenotypic tests to detect inducible clindamycin resistance in Bacteroides species. Anaerobe, 47: 226–232
https://doi.org/10.1016/j.anaerobe.2017.06.004 pmid: 28602805
20 P Liu, S Jia, X He, X Zhang, L Ye (2017). Different impacts of manure and chemical fertilizers on bacterial community structure and antibiotic resistance genes in arable soils. Chemosphere, 188: 455–464
https://doi.org/10.1016/j.chemosphere.2017.08.162 pmid: 28898777
21 R K Lu (2000). Analysis Methods of Soil and Agricultural Chemistry. Beijing: Chinese Agriculture and Technology Press (in Chinese)
22 G Luo, C Rensing, H Chen, M Q Liu, M Wang, S W Guo, N Ling, Q R Shen (2018). Deciphering the associations between soil microbial diversity and ecosystem multifunctionality driven by long-term fertilization management. Functional Ecology, 32(4): 1103–1116
https://doi.org/10.1111/1365-2435.13039
23 Y Negreanu, Z Pasternak, E Jurkevitch, E Cytryn (2012). Impact of treated wastewater irrigation on antibiotic resistance in agricultural soils. Environmental Science & Technology, 46(9): 4800–4808
https://doi.org/10.1021/es204665b pmid: 22494147
24 L K Ng, I Martin, M Alfa, M Mulvey (2001). Multiplex PCR for the detection of tetracycline resistant genes. Molecular and Cellular Probes, 15(4): 209–215
https://doi.org/10.1006/mcpr.2001.0363 pmid: 11513555
25 C C Nguyen, C N Hugie, M L Kile, T Navab-Daneshmand (2019). Association between heavy metals and antibiotic-resistant human pathogens in environmental reservoirs: A review. Frontiers of Environmental Science & Engineering, 13(3): 46
https://doi.org/10.1007/s11783-019-1129-0
26 S Peng, Y Feng, Y Wang, X Guo, H Chu, X Lin (2017). Prevalence of antibiotic resistance genes in soils after continually applied with different manure for 30 years. Journal of Hazardous Materials, 340: 16–25
https://doi.org/10.1016/j.jhazmat.2017.06.059 pmid: 28711829
27 A Pruden, R Pei, H Storteboom, K H Carlson (2006). Antibiotic resistance genes as emerging contaminants: Studies in northern Colorado. Environmental Science & Technology, 40(23): 7445–7450
https://doi.org/10.1021/es060413l pmid: 17181002
28 C Pu, H Liu, G Ding, Y Sun, X Yu, J Chen, J Ren, X Gong (2018). Impact of direct application of biogas slurry and residue in fields: In situ analysis of antibiotic resistance genes from pig manure to fields. Journal of Hazardous Materials, 344: 441–449
https://doi.org/10.1016/j.jhazmat.2017.10.031 pmid: 29096257
29 C P Rosewarne, V Pettigrove, H W Stokes, Y M Parsons (2010). Class 1 integrons in benthic bacterial communities: Abundance, association with Tn402-like transposition modules and evidence for coselection with heavy-metal resistance. FEMS Microbiology Ecology, 72(1): 35–46
https://doi.org/10.1111/j.1574-6941.2009.00823.x pmid: 20132306
30 V K Sharma, N Johnson, L Cizmas, T J McDonald, H Kim (2016). A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes. Chemosphere, 150: 702–714
https://doi.org/10.1016/j.chemosphere.2015.12.084 pmid: 26775188
31 V K Sharma, X Yu, T J McDonald, C Jinadatha, D D Dionysiou, M Feng (2019). Elimination of antibiotic resistance genes and control of horizontal transfer risk by UV-based treatment of drinking water: A mini review. Frontiers of Environmental Science & Engineering, 13(3): 37
https://doi.org/10.1007/s11783-019-1122-7
32 J Shi, X Yu, M Zhang, S Lu, W Wu, J Wu, J Xu (2011). Potential risks of copper, zinc, and cadmium pollution due to pig manure application in a soil-rice system under intensive farming: a case study of Nanhu, China. Journal of Environmental Quality, 40(6): 1695–1704
https://doi.org/10.2134/jeq2010.0316 pmid: 22031551
33 M T Suzuki, L T Taylor, E F DeLong (2000). Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5′-nuclease assays. Applied and Environmental Microbiology, 66(11): 4605–4614
https://doi.org/10.1128/AEM.66.11.4605-4614.2000 pmid: 11055900
34 N Udikovic-Kolic, F Wichmann, N A Broderick, J Handelsman (2014). Bloom of resident antibiotic-resistant bacteria in soil following manure fertilization. Proceedings of the National Academy of Sciences of the United States of America, 111(42): 15202–15207
https://doi.org/10.1073/pnas.1409836111 pmid: 25288759
35 F H Wang, M Qiao, Z E Lv, G X Guo, Y Jia, Y H Su, Y G Zhu (2014). Impact of reclaimed water irrigation on antibiotic resistance in public parks, Beijing, China. Environmental Pollution, 184: 247–253
https://doi.org/10.1016/j.envpol.2013.08.038 pmid: 24071635
36 M Wang, P Liu, W Xiong, Q Zhou, J Wangxiao, Z Zeng, Y Sun (2018). Fate of potential indicator antimicrobial resistance genes (ARGs) and bacterial community diversity in simulated manure-soil microcosms. Ecotoxicology and Environmental Safety, 147: 817–823
https://doi.org/10.1016/j.ecoenv.2017.09.055 pmid: 28958128
37 N Wu, M Qiao, B Zhang, W D Cheng, Y G Zhu (2010). Abundance and diversity of tetracycline resistance genes in soils adjacent to representative swine feedlots in China. Environmental Science & Technology, 44(18): 6933–6939
https://doi.org/10.1021/es1007802 pmid: 20707363
38 W Y Xie, S T Yuan, M G Xu, X P Yang, Q R Shen, W W Zhang, J Q Su, F J Zhao (2018). Long-term effects of manure and chemical fertilizers on soil antibiotic resistome. Soil Biology & Biochemistry, 122: 111–119
https://doi.org/10.1016/j.soilbio.2018.04.009
39 W Xiong, Y Sun, X Ding, Y Zhang, X Zhong, W Liang, Z Zeng (2015). Responses of plasmid-mediated quinolone resistance genes and bacterial taxa to (fluoro)quinolones-containing manure in arable soil. Chemosphere, 119: 473–478
https://doi.org/10.1016/j.chemosphere.2014.07.040 pmid: 25108677
40 Y Xu, W Yu, Q Ma, H Zhou (2015). Occurrence of (fluoro)quinolones and (fluoro)quinolone resistance in soil receiving swine manure for 11 years. Science of the Total Environment, 530– 531: 191–197
https://doi.org/10.1016/j.scitotenv.2015.04.046 pmid: 26042895
41 F Yang, K Zhang, S Zhi, J Li, X Tian, Y Gu, J Zhou (2019). High prevalence and dissemination of b-lactamase genes in swine farms in northern China. Science of the Total Environment, 651(Pt 2): 2507–2513
https://doi.org/10.1016/j.scitotenv.2018.10.144 pmid: 30336440
42 A N Zhang, L G Li, L Ma, M R Gillings, J M Tiedje, T Zhang (2018a). Conserved phylogenetic distribution and limited antibiotic resistance of class 1 integrons revealed by assessing the bacterial genome and plasmid collection. Microbiome, 6(1): 130
https://doi.org/10.1186/s40168-018-0516-2 pmid: 30031405
43 J Zhang, M Chen, Q Sui, J Tong, C Jiang, X Lu, Y Zhang, Y Wei (2016). Impacts of addition of natural zeolite or a nitrification inhibitor on antibiotic resistance genes during sludge composting. Water Research, 91: 339–349
https://doi.org/10.1016/j.watres.2016.01.010 pmid: 26808292
44 L Zhang, J Gu, X Wang, R Zhang, X Tuo, A Guo, L Qiu (2018b). Fate of antibiotic resistance genes and mobile genetic elements during anaerobic co-digestion of Chinese medicinal herbal residues and swine manure. Bioresource Technology, 250: 799–805
https://doi.org/10.1016/j.biortech.2017.10.100 pmid: 30001586
45 S Zhang, F Zhang, X Liu, Y Wang, S Zou, X He (2005). Determination and analysis on main harmful composition in excrement of scale livestock and poultry feedlots. Plant Nutrition and Fertilizing Science, 11(6): 822–829 (in Chinese)
46 X Zhang, B Wu, Y Zhang, T Zhang, L Yang, H H P Fang, T Ford, S Cheng (2009). Class 1 integronase gene and tetracycline resistance genes tetA and tetC in different water environments of Jiangsu Province, China. Ecotoxicology (London, England), 18(6): 652–660
https://doi.org/10.1007/s10646-009-0332-3 pmid: 19495963
47 Y J Zhang, H W Hu, M Gou, J T Wang, D Chen, J Z He (2017). Temporal succession of soil antibiotic resistance genes following application of swine, cattle and poultry manures spiked with or without antibiotics. Environmental Pollution, 231(Pt 2): 1621–1632
https://doi.org/10.1016/j.envpol.2017.09.074 pmid: 28964602
48 Z Zhao, J Wang, Y Han, J Chen, G Liu, H Lu, B Yan, S Chen (2017). Nutrients, heavy metals and microbial communities co-driven distribution of antibiotic resistance genes in adjacent environment of mariculture. Environmental Pollution, 220(Pt B): 909–918
https://doi.org/10.1016/j.envpol.2016.10.075 pmid: 27814984
49 X Zhou, M Qiao, F H Wang, Y G Zhu (2017). Use of commercial organic fertilizer increases the abundance of antibiotic resistance genes and antibiotics in soil. Environmental Science and Pollution Research International, 24(1): 701–710
https://doi.org/10.1007/s11356-016-7854-z pmid: 27752947
50 B Zhu, Q Chen, S Chen, Y G Zhu (2017). Does organically produced lettuce harbor higher abundance of antibiotic resistance genes than conventionally produced? Environment International, 98: 152–159
https://doi.org/10.1016/j.envint.2016.11.001 pmid: 27823798
51 Y G Zhu, T A Johnson, J Q Su, M Qiao, G X Guo, R D Stedtfeld, S A Hashsham, J M Tiedje (2013). Diverse and abundant antibiotic resistance genes in Chinese swine farms. Proceedings of the National Academy of Sciences of the United States of America, 110(9): 3435–3440
https://doi.org/10.1073/pnas.1222743110 pmid: 23401528
[1] FSE-19072-OF-WN_suppl_1 Download
[1] Chengjie Xue, Juan Wu, Kuang Wang, Yunqiang Yi, Zhanqiang Fang, Wen Cheng, Jianzhang Fang. Effects of different types of biochar on the properties and reactivity of nano zero-valent iron in soil remediation[J]. Front. Environ. Sci. Eng., 2021, 15(5): 101-.
[2] Yuan Meng, Weiyi Liu, Heidelore Fiedler, Jinlan Zhang, Xinrui Wei, Xiaohui Liu, Meng Peng, Tingting Zhang. Fate and risk assessment of emerging contaminants in reclaimed water production processes[J]. Front. Environ. Sci. Eng., 2021, 15(5): 104-.
[3] Qinxue Wen, Shuo Yang, Zhiqiang Chen. Mesophilic and thermophilic anaerobic digestion of swine manure with sulfamethoxazole and norfloxacin: Dynamics of microbial communities and evolution of resistance genes[J]. Front. Environ. Sci. Eng., 2021, 15(5): 94-.
[4] Kehui Liu, Jie Xu, Chenglong Dai, Chunming Li, Yi Li, Jiangming Ma, Fangming Yu. Exogenously applied oxalic acid assists in the phytoremediation of Mn by Polygonum pubescens Blume cultivated in three Mn-contaminated soils[J]. Front. Environ. Sci. Eng., 2021, 15(5): 86-.
[5] Junlian Qiao, Yang Liu, Hongyi Yang, Xiaohong Guan, Yuankui Sun. Remediation of arsenic contaminated soil by sulfidated zero-valent iron[J]. Front. Environ. Sci. Eng., 2021, 15(5): 83-.
[6] Haiyan Mou, Wenchao Liu, Lili Zhao, Wenqing Chen, Tianqi Ao. Stabilization of hexavalent chromium with pretreatment and high temperature sintering in highly contaminated soil[J]. Front. Environ. Sci. Eng., 2021, 15(4): 61-.
[7] Pil Uthaug Rasmussen, Katrine Uhrbrand, Mette Damkjær Bartels, Helle Neustrup, Dorina Gabriela Karottki, Ute Bültmann, Anne Mette Madsen. Occupational risk of exposure to methicillin-resistant Staphylococcus aureus (MRSA) and the quality of infection hygiene in nursing homes[J]. Front. Environ. Sci. Eng., 2021, 15(3): 41-.
[8] Xianke Lin, Xiaohong Chen, Sichang Li, Yangmei Chen, Zebin Wei, Qitang Wu. Sewage sludge ditch for recovering heavy metals can improve crop yield and soil environmental quality[J]. Front. Environ. Sci. Eng., 2021, 15(2): 22-.
[9] Weichuan Qiao, Rong Li, Tianhao Tang, Achuo Anitta Zuh. Removal, distribution and plant uptake of perfluorooctane sulfonate (PFOS) in a simulated constructed wetland system[J]. Front. Environ. Sci. Eng., 2021, 15(2): 20-.
[10] Hanli Wan, Jianmin Bian, Han Zhang, Yihan Li. Assessment of future climate change impacts on water-heat-salt migration in unsaturated frozen soil using CoupModel[J]. Front. Environ. Sci. Eng., 2021, 15(1): 10-.
[11] Marzieh Mokarram, Hamid Reza Pourghasemi, Huichun Zhang. Predicting non-carcinogenic hazard quotients of heavy metals in pepper (Capsicum annum L.) utilizing electromagnetic waves[J]. Front. Environ. Sci. Eng., 2020, 14(6): 114-.
[12] Qingkun Ji, Caihong Zhang, Dan Li. Influences and mechanisms of nanofullerene on the horizontal transfer of plasmid-encoded antibiotic resistance genes between E. coli strains[J]. Front. Environ. Sci. Eng., 2020, 14(6): 108-.
[13] Wenzhong Tang, Liu Sun, Limin Shu, Chuang Wang. Evaluating heavy metal contamination of riverine sediment cores in different land-use areas[J]. Front. Environ. Sci. Eng., 2020, 14(6): 104-.
[14] Kehui Liu, Xiaolu Liang, Chunming Li, Fangming Yu, Yi Li. Nutrient status and pollution levels in five areas around a manganese mine in southern China[J]. Front. Environ. Sci. Eng., 2020, 14(6): 100-.
[15] Sana Ullah, Xuejun Guo, Xiaoyan Luo, Xiangyuan Zhang, Siwen Leng, Na Ma, Palwasha Faiz. Rapid and long-effective removal of broad-spectrum pollutants from aqueous system by ZVI/oxidants[J]. Front. Environ. Sci. Eng., 2020, 14(5): 89-.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed